Strain Name:
C57BL/6J-MtgxR8501Btlr/Mmmh
Stock Number:
067838-MU
Citation ID:
RRID:MMRRC_067838-MU
Other Names:
R8501 (G1)
Major Collection:

Strain Information

Rgs3
Name: regulator of G-protein signaling 3
Synonyms: PDZ-RGS3, 4930506N09Rik, RGS3S, C2PA-RGS3, C2pa
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 50780
HGNC: HGNC:9999
Homologene: 32440
Nfya
Name: nuclear transcription factor-Y alpha
Synonyms: Cbf-b, Sez10
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18044
HGNC: HGNC:7804
Homologene: 32114
Rcc2
Name: regulator of chromosome condensation 2
Synonyms: 2610510H01Rik, Td60, 2610529N02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 108911
Homologene: 10282
Cep68
Name: centrosomal protein 68
Synonyms: 6030463E10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216543
Homologene: 65235
Gpr165
Name: G protein-coupled receptor 165
Synonyms: 6530406P05Rik
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 76206
Homologene: 85287
Mme
Name: membrane metallo endopeptidase
Synonyms: CD10, NEP, neprilysin, 6030454K05Rik, neutral endopeptidase
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17380
HGNC: HGNC:7154
Homologene: 5275
Ccdc171
Name: coiled-coil domain containing 171
Synonyms: 4930473A06Rik, A330015D16Rik, 4930418J05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320226
Homologene: 27942
Vps13a
Name: vacuolar protein sorting 13A
Synonyms: D330038K10Rik, 4930516E05Rik, 4930543C13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 271564
VEGA: 19
HGNC: HGNC:1908
Homologene: 22068
Idh2
Name: isocitrate dehydrogenase 2 (NADP+), mitochondrial
Synonyms: Idh-2, IDPm
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269951
HGNC: HGNC:5383
Homologene: 37590
Klf7
Name: Kruppel-like transcription factor 7 (ubiquitous)
Synonyms: 9830124P08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 93691
HGNC: HGNC:6350
Homologene: 2751
Piezo2
Name: piezo-type mechanosensitive ion channel component 2
Synonyms: 9030411M15Rik, Piezo2, Fam38b, Fam38b2, 9430028L06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 667742
Homologene: 49695
Setmar
Name: SET domain without mariner transposase fusion
Synonyms: 5830404F24Rik, Etet2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74729
Homologene: 68519
Naip6
Name: NLR family, apoptosis inhibitory protein 6
Synonyms: Naip-rs4A, Birc1f, Naip-rs4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17952
HGNC: HGNC:7634
Homologene: 113589
Vmn2r78
Name: vomeronasal 2, receptor 78
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 637896
Homologene: 115466
Unc79
Name: unc-79 homolog
Synonyms: 9030205A07Rik, Mlca3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217843
Homologene: 41397
Pcdhb13
Name: protocadherin beta 13
Synonyms: Pcdbh6, PcdhbM
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93884
HGNC: HGNC:8691
Homologene: 10338
Phf8l
Name: PHD finger protein 8 like
Synonyms: 4921501E09Rik, Phf8-ps
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74042
VEGA: 17
Homologene: 66275
Cacna1i
Name: calcium channel, voltage-dependent, alpha 1I subunit
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239556
HGNC: HGNC:1396
Homologene: 69331
Chrnd
Name: cholinergic receptor, nicotinic, delta polypeptide
Synonyms: Acrd, Achr-4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11447
HGNC: HGNC:1965
Homologene: 37340
Elfn2
Name: leucine rich repeat and fibronectin type III, extracellular 2
Synonyms: Lrrc62
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 207393
VEGA: 15
Homologene: 18835
Otogl
Name: otogelin-like
Synonyms: Gm6924
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 628870
Homologene: 46008
Atg2a
Name: autophagy related 2A
Synonyms: 1810013C15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 329015
Homologene: 86985
Plekha6
Name: pleckstrin homology domain containing, family A member 6
Synonyms: Pepp3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240753
Homologene: 135779
Or1j17
Name: olfactory receptor family 1 subfamily J member 17
Synonyms: MOR136-11, GA_x6K02T2NLDC-33382467-33383396, Olfr346
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258940
Homologene: 133616
Grm8
Name: glutamate receptor, metabotropic 8
Synonyms: Gprc1h, mGluR8
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14823
HGNC: HGNC:4600
Homologene: 654
Col6a2
Name: collagen, type VI, alpha 2
Synonyms: Col6a-2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12834
HGNC: HGNC:2212
Homologene: 1392
Sp140
Name: Sp140 nuclear body protein
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 434484
Homologene: 128391
Agbl2
Name: ATP/GTP binding protein-like 2
Synonyms: A430081C19Rik, Ccp2, Ccp2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 271813
Homologene: 11715
Trim30c
Name: tripartite motif-containing 30C
Synonyms: Gm5598, Trim30-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434219
5031439G07Rik
Name: RIKEN cDNA 5031439G07 gene
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223739
HGNC: HGNC:1314
Homologene: 15140
Atp8b3
Name: ATPase, class I, type 8B, member 3
Synonyms: SAPLT, 1700042F02Rik, 1700056N23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67331
VEGA: 10
Homologene: 19034
Slc9a9
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 9
Synonyms: 5730527A11Rik, Nhe9
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 331004
Homologene: 69753
Musk
Name: muscle, skeletal, receptor tyrosine kinase
Synonyms: Nsk1, Nsk2, Nsk3, MDK4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18198
HGNC: HGNC:7525
Homologene: 4084
Vwa2
Name: von Willebrand factor A domain containing 2
Synonyms: Amaco
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240675
Homologene: 18238
Naa30
Name: N(alpha)-acetyltransferase 30, NatC catalytic subunit
Synonyms: Nat12, 5730533P17Rik, 4930487N19Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 70646
Homologene: 17947
Atg3
Name: autophagy related 3
Synonyms: Apg3l, PC3-96, APG3, 2610016C12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67841
Homologene: 6836
Or14j5
Name: olfactory receptor family 14 subfamily J member 5
Synonyms: GA_x6K02T2PSCP-2307164-2308123, Olfr126, MOR218-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258892
Homologene: 134080
Scly
Name: selenocysteine lyase
Synonyms: Scly2, A930015N15Rik, Scly1, SCL, Selenocysteine reductase
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 50880
Homologene: 9548
Or51b6
Name: olfactory receptor family 51 subfamily B member 6
Synonyms: 5'[b]3, MOR1-2, Olfr65, GA_x6K02T2PBJ9-6634906-6633983
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18365
Homologene: 66459
P4ha3
Name: procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide III
Synonyms: D930031A02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320452
Homologene: 27943
Dlg2
Name: discs large MAGUK scaffold protein 2
Synonyms: B230218P12Rik, A330103J02Rik, Dlgh2, B330007M19Rik, Gm21505, PSD93, LOC382816, Chapsyn-110
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 23859
HGNC: HGNC:2901
Homologene: 1046
Zfp40
Name: zinc finger protein 40
Synonyms: Zfp-40, NTfin12
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22700
Homologene: 136312
Wfdc2
Name: WAP four-disulfide core domain 2
Synonyms: WAP5, 1600023A02Rik, HE4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67701
Homologene: 4450
Rapgefl1
Name: Rap guanine nucleotide exchange factor (GEF)-like 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268480
Homologene: 41126
Igf2
Name: insulin-like growth factor 2
Synonyms: M6pr, Mpr, Igf-2, Igf-II, Peg2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16002
HGNC: HGNC:5466
Homologene: 510
Krtap5-24
Name: keratin associated protein 5-24
Synonyms: Gm40460
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 105244938
Vmn1r151
Name: vomeronasal 1 receptor 151
Synonyms: Gm5727
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 435947
Homologene: 104166
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 64,079,163 bp
  • A to T, chromosome 1 at 85,641,740 bp
  • T to C, chromosome 1 at 87,192,616 bp
  • A to G, chromosome 1 at 91,319,076 bp
  • T to A, chromosome 1 at 133,287,837 bp
  • A to G, chromosome 2 at 36,688,797 bp
  • G to A, chromosome 2 at 90,797,564 bp
  • A to G, chromosome 2 at 164,563,359 bp
  • T to A, chromosome 3 at 63,326,735 bp
  • G to C, chromosome 4 at 58,367,502 bp
  • G to T, chromosome 4 at 62,602,956 bp
  • G to T, chromosome 4 at 83,663,658 bp
  • T to C, chromosome 4 at 140,715,926 bp
  • A to T, chromosome 6 at 27,618,541 bp
  • T to A, chromosome 6 at 108,075,861 bp
  • A to T, chromosome 7 at 22,499,609 bp
  • TCCCAGG to T, chromosome 7 at 80,098,331 bp
  • T to C, chromosome 7 at 86,920,886 bp
  • C to A, chromosome 7 at 92,375,722 bp
  • A to G, chromosome 7 at 100,313,355 bp
  • T to A, chromosome 7 at 103,906,611 bp
  • G to C, chromosome 7 at 104,387,470 bp
  • ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,713 bp
  • G to C, chromosome 7 at 142,654,042 bp
  • A to G, chromosome 9 at 94,855,739 bp
  • G to T, chromosome 10 at 76,603,557 bp
  • A to G, chromosome 10 at 80,520,146 bp
  • A to T, chromosome 10 at 107,790,560 bp
  • A to T, chromosome 11 at 20,239,132 bp
  • A to G, chromosome 11 at 98,842,227 bp
  • G to A, chromosome 12 at 103,092,638 bp
  • C to T, chromosome 13 at 100,300,276 bp
  • C to A, chromosome 14 at 49,172,896 bp
  • G to T, chromosome 15 at 78,674,300 bp
  • T to C, chromosome 15 at 80,382,046 bp
  • C to T, chromosome 15 at 84,960,523 bp
  • C to A, chromosome 16 at 45,182,931 bp
  • T to A, chromosome 17 at 23,178,298 bp
  • C to A, chromosome 17 at 33,067,064 bp
  • A to G, chromosome 17 at 37,850,865 bp
  • A to G, chromosome 17 at 48,398,989 bp
  • A to T, chromosome 18 at 37,444,440 bp
  • A to G, chromosome 18 at 63,045,540 bp
  • T to C, chromosome 19 at 6,254,390 bp
  • T to C, chromosome 19 at 16,682,120 bp
  • T to C, chromosome 19 at 56,908,982 bp
  • C to A, chromosome X at 96,714,017 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8501 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067838-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.