Strain Name:
C57BL/6J-MtgxR8418Btlr/Mmmh
Stock Number:
067897-MU
Citation ID:
RRID:MMRRC_067897-MU
Other Names:
R8418 (G1)
Major Collection:

Strain Information

Arfgef2
Name: ADP ribosylation factor guanine nucleotide exchange factor 2
Synonyms: BIG2, E230011G24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99371
Homologene: 111880
Timeless
Name: timeless circadian clock 1
Synonyms: tim
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21853
Homologene: 31206
Gars1
Name: glycyl-tRNA synthetase 1
Synonyms: Gars, GENA202, Sgrp23, Gena201
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 353172
HGNC: HGNC:4162
Homologene: 1547
Ptpn2
Name: protein tyrosine phosphatase, non-receptor type 2
Synonyms: TC-PTP, Ptpt
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 19255
HGNC: HGNC:9650
Homologene: 7497
Sec23ip
Name: Sec23 interacting protein
Synonyms: p125, D7Ertd373e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 207352
Homologene: 38288
Miga1
Name: mitoguardin 1
Synonyms: Fam73a, C030011O14Rik, Mita1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 215708
Homologene: 18369
Tacc1
Name: transforming, acidic coiled-coil containing protein 1
Synonyms: B230378H13Rik, 4833447E04Rik, Tacc1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 320165
Homologene: 4575
Pum2
Name: pumilio RNA-binding family member 2
Synonyms: Pumm2, 5730503J23Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 80913
Homologene: 69183
Hhip
Name: Hedgehog-interacting protein
Synonyms: Hip, Hhip1, Hip1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 15245
Homologene: 32469
Muc16
Name: mucin 16
Synonyms: LOC385009, 1110008I14Rik, Gm21044
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73732
Homologene: 141193
Garnl3
Name: GTPase activating RANGAP domain-like 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99326
Homologene: 13003
Dennd1a
Name: DENN domain containing 1A
Synonyms: 6030446I19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227801
Homologene: 17141
Dock2
Name: dedicator of cyto-kinesis 2
Synonyms: MBC, Hch, CED-5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 94176
HGNC: HGNC:2988
Homologene: 37984
Gp1bb
Name: glycoprotein Ib, beta polypeptide
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 14724
VEGA: 16
HGNC: HGNC:4440
Homologene: 30972
Snx13
Name: sorting nexin 13
Synonyms: RGS-PX1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217463
VEGA: 12
Homologene: 41011
Dnah17
Name: dynein, axonemal, heavy chain 17
Synonyms: Dnahcl1, Dnahc17, LOC382552, 2810003K23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69926
HGNC: HGNC:2946
Homologene: 72102
Dcst2
Name: DC-STAMP domain containing 2
Synonyms: LOC329702
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329702
Homologene: 16951
Grik3
Name: glutamate receptor, ionotropic, kainate 3
Synonyms: Glur-7, Glur7
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14807
HGNC: HGNC:4581
Homologene: 73901
Dgkb
Name: diacylglycerol kinase, beta
Synonyms: DGK-beta, C630029D13Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217480
VEGA: 12
HGNC: HGNC:2850
Homologene: 37875
Ntsr2
Name: neurotensin receptor 2
Synonyms: NTRL, NT2R
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18217
VEGA: 12
HGNC: HGNC:8040
Homologene: 7452
Itgal
Name: integrin alpha L
Synonyms: Cd11a, Ly-15, LFA-1, Ly-21
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16408
HGNC: HGNC:6148
Homologene: 1666
Col6a5
Name: collagen, type VI, alpha 5
Synonyms: Col6a5, Gm7455
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 665033
Homologene: 122792
Dcaf17
Name: DDB1 and CUL4 associated factor 17
Synonyms: 4833418A01Rik, A030004A10Rik, 2810055O12Rik, A930009G19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75763
Homologene: 65979
Cpa3
Name: carboxypeptidase A3, mast cell
Synonyms: mast cell carboxypeptidase A, mMC-CPA, MC-CPA
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12873
HGNC: HGNC:2298
Homologene: 122138
Gabrr1
Name: gamma-aminobutyric acid type A receptor subunit rho 1
Synonyms: GABA-C
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14408
HGNC: HGNC:4090
Homologene: 20470
Bean1
Name: brain expressed, associated with Nedd4, 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 65115
Homologene: 110172
Tll2
Name: tolloid-like 2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 24087
VEGA: 19
Homologene: 56545
Cpne9
Name: copine family member IX
Synonyms: A730016F12Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 211232
Homologene: 84686
Serpina6
Name: serine (or cysteine) peptidase inhibitor, clade A, member 6
Synonyms: Cbg
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 12401
HGNC: HGNC:1540
Homologene: 20417
Efcab12
Name: EF-hand calcium binding domain 12
Synonyms: BC060267
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 212516
Homologene: 18905
Kash5
Name: KASH domain containing 5
Synonyms: Ccdc155, LOC384619
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384619
Homologene: 16973
Vmn2r60
Name: vomeronasal 2, receptor 60
Synonyms: Gprc2a-rs3, Casr-rs3, EG637898
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 637898
Homologene: 129683
Thoc2l
Name: THO complex subunit 2-like
Synonyms: BC005561, Gm3179
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100042165
Gbp2b
Name: guanylate binding protein 2b
Synonyms: Gbp1, Mag-1, LIMIT, Mpa1, Mpa-1, Gbp-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14468
Homologene: 137233
Ccdc62
Name: coiled-coil domain containing 62
Synonyms: LOC208908, G1-485-3, repro29
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 208908
Homologene: 82466
Radil
Name: Ras association and DIL domains
Synonyms: D930005D10Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231858
Homologene: 77648
Tmem171
Name: transmembrane protein 171
Synonyms: LOC380863
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 380863
Homologene: 18301
Ttll3
Name: tubulin tyrosine ligase-like family, member 3
Synonyms: 4833441J24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101100
Homologene: 134361
Krt1
Name: keratin 1
Synonyms: Krt2-1, Krt-2.1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16678
VEGA: 15
HGNC: HGNC:6412
Homologene: 38146
Irgm1
Name: immunity-related GTPase family M member 1
Synonyms: Iigp3, LRG-47, Irgm, Ifi1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15944
Homologene: 134089
Adgrf2
Name: adhesion G protein-coupled receptor F2
Synonyms: PGR20, Gpr111
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 435529
Homologene: 45213
Cimip2b
Name: ciliary microtubule inner protein 2B
Synonyms: Fam166b, 4833436C18Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329831
Homologene: 52229
Zfp977
Name: zinc finger protein 977
Synonyms: Gm7221
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 637776
Erich3
Name: glutamate rich 3
Synonyms: 5031409G23Rik, 4922501L14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 209601
Homologene: 27877
Gm9602
Name: predicted gene 9602
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 673676
Homologene: 115686
Vmn2r43
Name: vomeronasal 2, receptor 43
Synonyms: EC2-V2R
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381838
Homologene: 113703
Or52ab2
Name: olfactory receptor family 52 subfamily AB member 2
Synonyms: MOR23-2, GA_x6K02T2PBJ9-6029614-6030561, Olfr597
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258135
Homologene: 132401
Rdh14
Name: retinol dehydrogenase 14 (all-trans and 9-cis)
Synonyms: 3110030G19Rik, PAN2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 105014
VEGA: 12
Homologene: 75139
Vmn2r29
Name: vomeronasal 2, receptor 29
Synonyms: 6430701C03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76229
Homologene: 113703
Gm28360
Name: predicted gene 28360
Type: Gene
Species: Mouse
Chromosome: 1
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 117,853,627 bp
  • G to T, chromosome 2 at 33,052,146 bp
  • T to C, chromosome 2 at 37,858,391 bp
  • T to A, chromosome 2 at 71,088,373 bp
  • T to C, chromosome 2 at 166,856,548 bp
  • T to C, chromosome 3 at 20,222,151 bp
  • T to C, chromosome 3 at 89,371,594 bp
  • A to T, chromosome 3 at 142,603,705 bp
  • T to G, chromosome 3 at 152,285,317 bp
  • C to T, chromosome 3 at 154,709,741 bp
  • C to T, chromosome 4 at 33,162,615 bp
  • A to G, chromosome 4 at 43,427,204 bp
  • A to G, chromosome 4 at 125,686,042 bp
  • C to A, chromosome 5 at 104,519,858 bp
  • C to T, chromosome 5 at 123,946,392 bp
  • T to C, chromosome 5 at 142,494,921 bp
  • A to G, chromosome 6 at 55,065,461 bp
  • A to G, chromosome 6 at 113,283,437 bp
  • A to T, chromosome 6 at 113,394,773 bp
  • A to G, chromosome 6 at 115,822,115 bp
  • T to A, chromosome 7 at 7,241,940 bp
  • A to T, chromosome 7 at 8,255,584 bp
  • A to G, chromosome 7 at 42,195,426 bp
  • T to A, chromosome 7 at 42,579,986 bp
  • A to G, chromosome 7 at 45,194,077 bp
  • A to G, chromosome 7 at 103,321,071 bp
  • A to T, chromosome 7 at 127,330,282 bp
  • T to G, chromosome 7 at 128,778,463 bp
  • T to C, chromosome 8 at 25,241,516 bp
  • T to C, chromosome 8 at 80,045,085 bp
  • CT to C, chromosome 8 at 104,182,032 bp
  • A to T, chromosome 9 at 18,519,630 bp
  • G to T, chromosome 9 at 105,878,622 bp
  • A to C, chromosome 10 at 128,250,736 bp
  • A to G, chromosome 11 at 34,718,968 bp
  • A to G, chromosome 11 at 48,866,339 bp
  • G to A, chromosome 11 at 118,103,458 bp
  • T to A, chromosome 12 at 8,710,245 bp
  • T to C, chromosome 12 at 10,394,580 bp
  • T to G, chromosome 12 at 16,656,661 bp
  • T to A, chromosome 12 at 35,098,234 bp
  • C to A, chromosome 12 at 38,330,017 bp
  • T to C, chromosome 12 at 103,646,928 bp
  • A to G, chromosome 13 at 98,692,232 bp
  • T to A, chromosome 14 at 4,779,201 bp
  • AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC to AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC, chromosome 15 at 101,850,378 bp
  • T to A, chromosome 16 at 18,621,353 bp
  • T to C, chromosome 17 at 42,710,586 bp
  • G to A, chromosome 18 at 67,681,522 bp
  • C to A, chromosome 19 at 41,092,837 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8418 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067897-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.