Strain Name:
C57BL/6J-MtgxR8463Btlr/Mmmh
Stock Number:
067907-MU
Citation ID:
RRID:MMRRC_067907-MU
Other Names:
R8463 (G1)
Major Collection:

Strain Information

Gjd2
Name: gap junction protein, delta 2
Synonyms: Gja9, connexin36, Cx36
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14617
Homologene: 7734
Spen
Name: spen family transcription repressor
Synonyms: Mint
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56381
Homologene: 124461
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: b2b1625.2Clo, D230004K18Rik, Gp330, Megalin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Mif4gd
Name: MIF4G domain containing
Synonyms: 1110014L05Rik, 2310075G12Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69674
Homologene: 41389
Xpnpep3
Name: X-prolyl aminopeptidase 3, mitochondrial
Synonyms: E430012M05Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 321003
Mybl2
Name: myeloblastosis oncogene-like 2
Synonyms: Bmyb, B-Myb
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17865
HGNC: HGNC:7548
Homologene: 1847
Cnot2
Name: CCR4-NOT transcription complex, subunit 2
Synonyms: 2600016M12Rik, 2810470K03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 72068
HGNC: HGNC:7878
Homologene: 40953
Bnc2
Name: basonuclin zinc finger protein 2
Synonyms: 5031434M05Rik, 8430420F16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242509
Homologene: 18243
Bub1
Name: BUB1, mitotic checkpoint serine/threonine kinase
Synonyms: D2Xrf87, Bub1a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12235
HGNC: HGNC:1148
Homologene: 37910
Smg6
Name: SMG6 nonsense mediated mRNA decay factor
Synonyms: Smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103677
Homologene: 23024
Txnl4b
Name: thioredoxin-like 4B
Synonyms: Dim2, D530025J19Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234723
Homologene: 9880
Fam171b
Name: family with sequence similarity 171, member B
Synonyms: D430039N05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241520
Homologene: 18462
Zranb1
Name: zinc finger, RAN-binding domain containing 1
Synonyms: D7Wsu87e, 9330160G10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 360216
Homologene: 9728
Mlec
Name: malectin
Synonyms: ESTM19, 2410014A08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 109154
Homologene: 8823
Recql5
Name: RecQ protein-like 5
Synonyms: Recq5b, Recql5b
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 170472
HGNC: HGNC:9950
Homologene: 31232
Muc16
Name: mucin 16
Synonyms: LOC385009, 1110008I14Rik, Gm21044
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73732
Homologene: 141193
Pcca
Name: propionyl-Coenzyme A carboxylase, alpha polypeptide
Synonyms: C79630
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110821
HGNC: HGNC:8653
Homologene: 236
Tpm1
Name: tropomyosin 1, alpha
Synonyms: TM2, Tpm-1, Tm3, alpha-TM
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22003
Homologene: 128637
Gmds
Name: GDP-mannose 4, 6-dehydratase
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218138
HGNC: HGNC:4369
Homologene: 75968
Pop4
Name: processing of precursor 4, ribonuclease P/MRP family, (S. cerevisiae)
Synonyms: Rpp29, 1110023P21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66161
Homologene: 31392
Mtus1
Name: mitochondrial tumor suppressor 1
Synonyms: B430305I03Rik, MTSG1, Atip1, MD44
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102103
Homologene: 100292
Plxna2
Name: plexin A2
Synonyms: 2810428A13Rik, PlexA2, OCT, Plxn2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18845
HGNC: HGNC:9100
Homologene: 56427
Peg10
Name: paternally expressed 10
Synonyms: MyEF-3 like, Mar2, Mart2, MEF3L, HB-1, MyEF-3, Edr, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Fgd3
Name: FYVE, RhoGEF and PH domain containing 3
Synonyms: 5830461L01Rik, ZFYVE5
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 30938
Homologene: 22925
Gp2
Name: glycoprotein 2 zymogen granule membrane
Synonyms: 2310037I18Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67133
HGNC: HGNC:4441
Homologene: 133790
Trmt2a
Name: TRM2 tRNA methyltransferase 2A
Synonyms: Htf9c
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 15547
Homologene: 7374
Slc35e2
Name: solute carrier family 35, member E2
Synonyms: A530082C11Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320541
Homologene: 84987
Hydin
Name: HYDIN, axonemal central pair apparatus protein
Synonyms: 4930545D19Rik, 1700034M11Rik, hy3, hyrh, hy-3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244653
Homologene: 52118
Celsr1
Name: cadherin, EGF LAG seven-pass G-type receptor 1
Synonyms: Adgrc1, crash, Crsh, Scy
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12614
VEGA: 15
HGNC: HGNC:1850
Homologene: 7665
Sorcs1
Name: sortilin-related VPS10 domain containing receptor 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 58178
Homologene: 10967
Muc4
Name: mucin 4
Synonyms: 4933405I11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 140474
HGNC: HGNC:7514
Homologene: 124469
Lama3
Name: laminin, alpha 3
Synonyms: nicein, 150kDa, [a]3B
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 16774
HGNC: HGNC:6483
Homologene: 18279
Abcg4
Name: ATP binding cassette subfamily G member 4
Synonyms: 6430517O04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 192663
Homologene: 75179
Hnmt
Name: histamine N-methyltransferase
Synonyms: 1500031F01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 140483
HGNC: HGNC:5028
Homologene: 5032
Adcy8
Name: adenylate cyclase 8
Synonyms: AC8
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11514
VEGA: 15
HGNC: HGNC:239
Homologene: 37443
Pcdhb13
Name: protocadherin beta 13
Synonyms: Pcdbh6, PcdhbM
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93884
HGNC: HGNC:8691
Homologene: 10338
Ahnak
Name: AHNAK nucleoprotein
Synonyms: 1110004P15Rik, DY6, 2310047C17Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66395
VEGA: 19
HGNC: HGNC:347
Homologene: 67425
Shank1
Name: SH3 and multiple ankyrin repeat domains 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243961
Homologene: 22949
Nepn
Name: nephrocan
Synonyms: periolin, 5730521E12Rik, Npn
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66650
Homologene: 23549
Nuggc
Name: nuclear GTPase, germinal center associated
Synonyms: LOC239151, SLIP-GC, Gm600
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100503545
Homologene: 72641
Mgarp
Name: mitochondria localized glutamic acid rich protein
Synonyms: Osap, 4930583H14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67749
Homologene: 49858
Vmn2r27
Name: vomeronasal 2, receptor27
Synonyms: EG232367
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232367
Krt87
Name: keratin 87
Synonyms: Krt2-25, Krt83
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 406219
VEGA: 15
Homologene: 133804
Mdga1
Name: MAM domain containing glycosylphosphatidylinositol anchor 1
Synonyms: Mamdc3, 1200011I03Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74762
Homologene: 17780
Dzip1l
Name: DAZ interacting protein 1-like
Synonyms: 2610524A10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72507
Homologene: 12466
Vmn2r14
Name: vomeronasal 2, receptor 14
Synonyms: EG231591
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231591
Homologene: 129606
Prss3
Name: serine protease 3
Synonyms: Try3, Tb, mesotrypsin, MTG, TRY4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22073
Homologene: 88408
BC005624
Name: cDNA sequence BC005624
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227707
Homologene: 9551
Lyg1
Name: lysozyme G-like 1
Synonyms: 2300002O18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 69541
Homologene: 18376
Gstm2
Name: glutathione S-transferase, mu 2
Synonyms: Gstb-2, Gstb2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14863
Homologene: 121492
Wee2
Name: WEE1 homolog 2 (S. pombe)
Synonyms: Wee1b, LOC381759
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 381759
Homologene: 52392
Rnf148
Name: ring finger protein 148
Synonyms: Greul3, 4933432M07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71300
Homologene: 82404
Cntn6
Name: contactin 6
Synonyms: NB-3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 53870
HGNC: HGNC:2176
Homologene: 8702
Or5w16
Name: olfactory receptor family 5 subfamily W member 16
Synonyms: Olfr1140, GA_x6K02T2Q125-49250025-49250960, MOR177-6
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258635
Homologene: 74081
Or51k2
Name: olfactory receptor family 51 subfamily K member 2
Synonyms: GA_x6K02T2PBJ9-6681230-6682168, MOR12-5, Olfr633
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258351
Homologene: 27136
Dlg2
Name: discs large MAGUK scaffold protein 2
Synonyms: B230218P12Rik, A330103J02Rik, Dlgh2, B330007M19Rik, Gm21505, PSD93, LOC382816, Chapsyn-110
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 23859
HGNC: HGNC:2901
Homologene: 1046
Plppr3
Name: phospholipid phosphatase related 3
Synonyms: BC005764, Lppr3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216152
Homologene: 11769
Cracd
Name: capping protein inhibiting regulator of actin
Synonyms: C530008M17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320827
Homologene: 136278
Gabrr2
Name: gamma-aminobutyric acid type A receptor subunit rho 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14409
HGNC: HGNC:4091
Homologene: 20471
Sftpd
Name: surfactant associated protein D
Synonyms: Sftp4, SP-D, Sfpd
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 20390
VEGA: 14
Homologene: 2272
Cdkn1c
Name: cyclin dependent kinase inhibitor 1C
Synonyms: CDKI, Kip2, p57Kip2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12577
HGNC: HGNC:1786
Homologene: 134519
Prss2
Name: serine protease 2
Synonyms: Try2, TRYP, Ta, TRY8, Tesp4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22072
HGNC: HGNC:9483
Homologene: 122141
Scgb1b19
Name: secretoglobin, family 1B, member 19
Synonyms: Gm5632, Abpa19
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434676
Homologene: 114479
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 37,949,841 bp
  • C to T, chromosome 1 at 194,644,046 bp
  • T to C, chromosome 2 at 24,048,824 bp
  • T to A, chromosome 2 at 30,981,805 bp
  • G to A, chromosome 2 at 69,491,906 bp
  • A to G, chromosome 2 at 83,853,457 bp
  • A to T, chromosome 2 at 87,747,093 bp
  • T to A, chromosome 2 at 114,011,572 bp
  • A to T, chromosome 2 at 127,817,433 bp
  • A to T, chromosome 2 at 163,074,718 bp
  • T to C, chromosome 3 at 51,388,927 bp
  • A to G, chromosome 3 at 107,986,356 bp
  • A to T, chromosome 4 at 33,084,375 bp
  • A to T, chromosome 4 at 84,293,371 bp
  • A to G, chromosome 4 at 141,522,279 bp
  • T to C, chromosome 4 at 155,610,158 bp
  • GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG to GCGCGAGGCCGAGAGGCAGG, chromosome 5 at 76,856,954 bp
  • C to A, chromosome 5 at 109,221,474 bp
  • T to C, chromosome 5 at 115,150,224 bp
  • C to CTCA, chromosome 6 at 4,756,453 bp
  • A to G, chromosome 6 at 23,654,802 bp
  • G to T, chromosome 6 at 40,443,980 bp
  • C to A, chromosome 6 at 41,375,125 bp
  • T to A, chromosome 6 at 41,521,805 bp
  • A to T, chromosome 6 at 104,772,619 bp
  • A to G, chromosome 6 at 124,192,209 bp
  • G to A, chromosome 7 at 33,287,657 bp
  • A to T, chromosome 7 at 38,263,175 bp
  • A to G, chromosome 7 at 44,354,181 bp
  • G to T, chromosome 7 at 91,968,233 bp
  • G to A, chromosome 7 at 103,946,627 bp
  • C to T, chromosome 7 at 119,454,331 bp
  • A to G, chromosome 7 at 132,950,081 bp
  • G to A, chromosome 7 at 143,460,587 bp
  • C to A, chromosome 8 at 41,083,234 bp
  • T to C, chromosome 8 at 109,572,798 bp
  • T to C, chromosome 8 at 110,510,921 bp
  • T to A, chromosome 9 at 18,659,139 bp
  • T to A, chromosome 9 at 44,281,612 bp
  • G to T, chromosome 9 at 67,048,230 bp
  • A to T, chromosome 9 at 99,637,822 bp
  • A to G, chromosome 10 at 52,400,800 bp
  • A to T, chromosome 10 at 79,867,563 bp
  • A to G, chromosome 10 at 116,517,331 bp
  • A to G, chromosome 11 at 74,930,060 bp
  • T to A, chromosome 11 at 115,608,498 bp
  • G to A, chromosome 11 at 115,896,793 bp
  • T to C, chromosome 13 at 31,819,923 bp
  • T to C, chromosome 13 at 49,266,605 bp
  • A to G, chromosome 14 at 41,175,626 bp
  • A to G, chromosome 14 at 65,613,562 bp
  • A to G, chromosome 14 at 122,685,114 bp
  • G to T, chromosome 15 at 64,921,025 bp
  • A to G, chromosome 15 at 81,448,471 bp
  • G to A, chromosome 15 at 86,030,214 bp
  • C to A, chromosome 15 at 101,434,625 bp
  • T to C, chromosome 16 at 18,251,175 bp
  • A to T, chromosome 16 at 32,752,401 bp
  • T to C, chromosome 17 at 29,849,729 bp
  • A to T, chromosome 18 at 12,449,839 bp
  • T to G, chromosome 18 at 37,443,234 bp
  • A to G, chromosome 19 at 9,008,749 bp
  • A to G, chromosome 19 at 50,259,810 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8463 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067907-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.