Strain Name:
C57BL/6J-MtgxR8769Btlr/Mmmh
Stock Number:
068624-MU
Citation ID:
RRID:MMRRC_068624-MU
Other Names:
R8769 (G1)
Major Collection:

Strain Information

Thbs3
Name: thrombospondin 3
Synonyms: TSP3, Thbs-3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 21827
Homologene: 5159
Hsd17b12
Name: hydroxysteroid (17-beta) dehydrogenase 12
Synonyms: 2610510O05Rik, keratoadhesin, keratonectin, KIK-I
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56348
Homologene: 95094
Prkca
Name: protein kinase C, alpha
Synonyms: Pkca
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18750
HGNC: HGNC:9393
Homologene: 55679
Bbx
Name: bobby sox HMG box containing
Synonyms: 5530401J07Rik, 5730403O13Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70508
Homologene: 10634
Adgrl2
Name: adhesion G protein-coupled receptor L2
Synonyms: Lec1, Lphh1, Lphn2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99633
Homologene: 22712
Sec62
Name: SEC62 homolog, preprotein translocation
Synonyms: 3100002M17Rik, SEC62, Tloc1, HTP1, Dtrp1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 69276
Homologene: 2449
Mdn1
Name: midasin AAA ATPase 1
Synonyms: 4833432B22Rik, LOC213784, D4Abb1e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100019
Homologene: 39689
G3bp2
Name: G3BP stress granule assembly factor 2
Synonyms: G3BP2, G3BP, E430034L04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 23881
Homologene: 137244
Asb6
Name: ankyrin repeat and SOCS box-containing 6
Synonyms: 2510004M11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72323
Homologene: 9895
Slc43a2
Name: solute carrier family 43, member 2
Synonyms: 7630402D21Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 215113
Homologene: 17555
Ppp6r1
Name: protein phosphatase 6, regulatory subunit 1
Synonyms: Pp6r1, 2010309P17Rik, Saps1, B430201G11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243819
Homologene: 86982
Clhc1
Name: clathrin heavy chain linker domain containing 1
Synonyms: 1700034F02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 73324
Homologene: 17569
Prune2
Name: prune homolog 2
Synonyms: A330102H22Rik, Olfaxin, 6330414G02Rik, A230083H22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 353211
VEGA: 19
Homologene: 18939
Ampd2
Name: adenosine monophosphate deaminase 2
Synonyms: Ampd-2, m4521Dajl, 1200014F01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109674
HGNC: HGNC:469
Homologene: 2979
Htt
Name: huntingtin
Synonyms: huntingtin, htt, IT15, Hdh, HD, C430023I11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15194
HGNC: HGNC:4851
Homologene: 1593
Pcca
Name: propionyl-Coenzyme A carboxylase, alpha polypeptide
Synonyms: C79630
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110821
HGNC: HGNC:8653
Homologene: 236
E4f1
Name: E4F transcription factor 1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13560
VEGA: 17
HGNC: HGNC:3121
Homologene: 3259
Ttc13
Name: tetratricopeptide repeat domain 13
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234875
Homologene: 11569
Nbeal1
Name: neurobeachin like 1
Synonyms: A530083I02Rik, ALS2CR17, A530050O19Rik, 2310076G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269198
Homologene: 16453
Hectd4
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269700
Homologene: 28297
Trpm2
Name: transient receptor potential cation channel, subfamily M, member 2
Synonyms: 9830168K16Rik, TRPC7, Trrp7, LTRPC2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 28240
Homologene: 20709
Muc5ac
Name: mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms: MGM, 2210005L13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17833
HGNC: HGNC:7515
Homologene: 137237
Rpgrip1l
Name: Rpgrip1-like
Synonyms: Nphp8, Ftm, 1700047E16Rik, fantom
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244585
Homologene: 18296
Cfap74
Name: cilia and flagella associated protein 74
Synonyms: 2010015L04Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 544678
Homologene: 129584
Lrrc37a
Name: leucine rich repeat containing 37A
Synonyms: LOC237954
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237954
Homologene: 138824
Zc3hav1
Name: zinc finger CCCH type, antiviral 1
Synonyms: ZAP, 2900058M19Rik, 9130009D18Rik, 1200014N16Rik, 9830115L13Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 78781
Homologene: 10585
Pkd1l3
Name: polycystic kidney disease 1 like 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244646
Homologene: 14627
Cul9
Name: cullin 9
Synonyms: 1810035I07Rik, Parc
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 78309
Homologene: 56696
Agbl3
Name: ATP/GTP binding protein-like 3
Synonyms: 4930431N21Rik, 6530406M24Rik, Ccp3, 2900053G10Rik, Ccp3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 76223
Homologene: 35330
Atosa
Name: atos homolog A
Synonyms: Fam214a, 6330415I01Rik, C130047D21Rik, BC031353
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235493
VEGA: 9
Homologene: 35065
Grik3
Name: glutamate receptor, ionotropic, kainate 3
Synonyms: Glur-7, Glur7
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14807
HGNC: HGNC:4581
Homologene: 73901
Mroh1
Name: maestro heat-like repeat family member 1
Synonyms: D330001F17Rik, Heatr7a
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223658
Homologene: 44882
Hecw2
Name: HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
Synonyms: Nedl2, D030049F17Rik, A730039N16Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329152
Homologene: 66192
Ccr3
Name: C-C motif chemokine receptor 3
Synonyms: CKR3, CC-CKR3, Cmkbr3, MIP-1 alphaRL2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12771
VEGA: 9
HGNC: HGNC:1604
Homologene: 20436
Ngef
Name: neuronal guanine nucleotide exchange factor
Synonyms: ephexin, Tims2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 53972
HGNC: HGNC:7807
Homologene: 75120
Col22a1
Name: collagen, type XXII, alpha 1
Synonyms: C80743, 2310067L16Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69700
Homologene: 43567
Itih1
Name: inter-alpha trypsin inhibitor, heavy chain 1
Synonyms: Itih-1, Intin1, inter-alpha (globulin) inhibitor, H1 polypeptide
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16424
HGNC: HGNC:6166
Homologene: 1667
Bcl9l
Name: B cell CLL/lymphoma 9-like
Synonyms: DLNB11
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 80288
VEGA: 9
Homologene: 65615
Zfp735
Name: zinc finger protein 735
Synonyms: 1700012C15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76390
Homologene: 88945
Smarcd3
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3
Synonyms: BAF60C, 2210409C08Rik, 1500001J14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 66993
Homologene: 2314
Myrfl
Name: myelin regulatory factor-like
Synonyms: LOC237558, Gm239
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237558
VEGA: 10
Homologene: 88588
Cttnbp2
Name: cortactin binding protein 2
Synonyms: 9130022E09Rik, Cortbp2, 4732477G22Rik, 3010022N24Rik, ORF4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 30785
Homologene: 14125
4933409G03Rik
Name: RIKEN cDNA 4933409G03 gene
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227998
Whamm
Name: WAS protein homolog associated with actin, golgi membranes and microtubules
Synonyms: Whdc1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434204
Homologene: 45851
Lypd3
Name: Ly6/Plaur domain containing 3
Synonyms: 2310061G07Rik, C4.4A
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72434
Homologene: 8672
Klk1b9
Name: kallikrein 1-related peptidase b9
Synonyms: Egfbp3, Klk9, Egfbp-3, mGk-9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13648
Homologene: 68141
Rad21l
Name: RAD21-like (S. pombe)
Synonyms: Gm14160
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 668929
Homologene: 82650
Tyms
Name: thymidylate synthase
Synonyms: TS
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22171
Homologene: 834
Edc3
Name: enhancer of mRNA decapping 3
Synonyms: Yjdc, Lsm16
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 353190
Homologene: 11827
Slc22a19
Name: solute carrier family 22 (organic anion transporter), member 19
Synonyms: D630043A20Rik, Oat5, Slc22a9
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 207151
Homologene: 133125
Or5ac20
Name: olfactory receptor family 5 subfamily AC member 20
Synonyms: Olfr202, GA_x54KRFPKG5P-55498766-55497843, MOR182-1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258997
Homologene: 138323
Or5b102
Name: olfactory receptor family 5 subfamily B member 102
Synonyms: GA_x6K02T2RE5P-3390804-3391727, MOR202-14, Olfr1454
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258687
HGNC: HGNC:8324
Homologene: 120159
Dyrk4
Name: dual-specificity tyrosine phosphorylation regulated kinase 4
Synonyms: Dyrk4a, Dyrk4b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101320
HGNC: HGNC:3095
Homologene: 37858
Or5w1b
Name: olfactory receptor family 5 subfamily W member 1B
Synonyms: GA_x6K02T2Q125-49151278-49150337, Olfr1133, MOR176-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258348
Ttc39c
Name: tetratricopeptide repeat domain 39C
Synonyms: 2810439F02Rik, 1700008N02Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 72747
Homologene: 124438
Ydjc
Name: YdjC homolog (bacterial)
Synonyms: 1810015A11Rik, 4930521M19Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 69101
Homologene: 19062
Tes3-ps
Name: testis derived transcript 3, pseudogene
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 54339
VEGA: 13
Eppk1
Name: epiplakin 1
Synonyms: EPPK, EPIPL1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223650
VEGA: 15
Homologene: 20006
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 53,913,348 bp
  • T to A, chromosome 1 at 60,235,211 bp
  • A to G, chromosome 1 at 87,481,161 bp
  • T to C, chromosome 2 at 30,828,131 bp
  • T to A, chromosome 2 at 68,616,245 bp
  • A to T, chromosome 2 at 87,645,616 bp
  • A to T, chromosome 2 at 94,115,052 bp
  • T to C, chromosome 2 at 151,667,918 bp
  • T to C, chromosome 3 at 30,810,028 bp
  • G to A, chromosome 3 at 89,224,630 bp
  • C to T, chromosome 3 at 108,075,297 bp
  • T to C, chromosome 3 at 148,817,281 bp
  • C to A, chromosome 4 at 32,751,390 bp
  • T to C, chromosome 4 at 125,656,373 bp
  • T to A, chromosome 4 at 155,418,648 bp
  • T to C, chromosome 5 at 24,598,794 bp
  • T to C, chromosome 5 at 30,073,362 bp
  • C to T, chromosome 5 at 34,820,289 bp
  • C to T, chromosome 5 at 92,083,497 bp
  • A to G, chromosome 5 at 121,281,873 bp
  • T to A, chromosome 6 at 18,376,004 bp
  • C to T, chromosome 6 at 34,857,614 bp
  • C to T, chromosome 6 at 38,336,481 bp
  • G to T, chromosome 6 at 126,880,245 bp
  • A to T, chromosome 7 at 4,641,290 bp
  • C to A, chromosome 7 at 24,638,507 bp
  • T to A, chromosome 7 at 43,980,242 bp
  • A to T, chromosome 7 at 81,585,185 bp
  • G to A, chromosome 7 at 141,818,872 bp
  • T to C, chromosome 8 at 91,252,584 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • A to T, chromosome 8 at 124,679,077 bp
  • T to A, chromosome 9 at 44,508,966 bp
  • C to T, chromosome 9 at 57,727,395 bp
  • C to A, chromosome 9 at 75,025,825 bp
  • T to A, chromosome 9 at 124,029,059 bp
  • A to T, chromosome 10 at 77,932,294 bp
  • A to T, chromosome 10 at 116,776,791 bp
  • G to A, chromosome 11 at 29,561,401 bp
  • G to A, chromosome 11 at 73,690,301 bp
  • G to T, chromosome 11 at 75,543,366 bp
  • A to G, chromosome 11 at 103,498,710 bp
  • A to T, chromosome 11 at 107,951,460 bp
  • T to A, chromosome 13 at 49,493,880 bp
  • A to G, chromosome 14 at 30,933,424 bp
  • A to G, chromosome 14 at 122,616,848 bp
  • A to T, chromosome 15 at 72,006,722 bp
  • A to G, chromosome 15 at 76,110,695 bp
  • A to G, chromosome 15 at 76,412,926 bp
  • A to G, chromosome 16 at 17,150,868 bp
  • T to C, chromosome 16 at 50,240,864 bp
  • A to G, chromosome 16 at 59,283,831 bp
  • C to T, chromosome 17 at 24,444,600 bp
  • T to C, chromosome 17 at 46,521,902 bp
  • T to C, chromosome 18 at 12,695,488 bp
  • C to T, chromosome 19 at 7,692,721 bp
  • T to A, chromosome 19 at 13,063,943 bp
  • A to G, chromosome 19 at 17,123,078 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8769 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068624-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.