Strain Name:
C57BL/6J-MtgxR8809Btlr/Mmmh
Stock Number:
068645-MU
Citation ID:
RRID:MMRRC_068645-MU
Other Names:
R8809 (G1)
Major Collection:

Strain Information

Lrig2
Name: leucine-rich repeats and immunoglobulin-like domains 2
Synonyms: 4632419I10Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 269473
Homologene: 8882
Chrnb2
Name: cholinergic receptor nicotinic beta 2 subunit
Synonyms: C030030P04Rik, Acrb-2, [b]2-nAchR, Acrb2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11444
HGNC: HGNC:1962
Homologene: 595
Neurog1
Name: neurogenin 1
Synonyms: Neurod3, neurogenin, bHLHa6, ngn1, neurogenin 1, Math4C
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18014
VEGA: 13
HGNC: HGNC:7764
Homologene: 4490
Ctnnal1
Name: catenin alpha like 1
Synonyms: catenin (cadherin associated protein), alpha-like 1, Catnal1, ACRP
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 54366
HGNC: HGNC:2512
Homologene: 2815
Zbtb7c
Name: zinc finger and BTB domain containing 7C
Synonyms: Zbtb36, B230208J24Rik, Kr-pok
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 207259
VEGA: 18
Homologene: 17070
Rock2
Name: Rho-associated coiled-coil containing protein kinase 2
Synonyms: Rock2m, B230113H15Rik, Rock-II, Rho-kinase, ROKalpha
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 19878
VEGA: 12
Homologene: 21010
Nf1
Name: neurofibromin 1
Synonyms: Mhdadsk9, neurofibromin, Nf-1, Dsk9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18015
HGNC: HGNC:7765
Homologene: 226
Ss18
Name: SS18, subunit of BAF chromatin remodeling complex
Synonyms: Ssxt
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 268996
VEGA: 18
Homologene: 38080
Tacc2
Name: transforming, acidic coiled-coil containing protein 2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57752
Homologene: 5087
Fxr1
Name: FMR1 autosomal homolog 1
Synonyms: 9530073J07Rik, Fxr1h, 1110050J02Rik, Fxr1p
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14359
HGNC: HGNC:4023
Homologene: 3573
Kifbp
Name: kinesin family binding protein
Synonyms: 2510003E04Rik, Kif1bp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 72320
Homologene: 9223
Fbxo15
Name: F-box protein 15
Synonyms: Fbx15, ecat3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 50764
VEGA: 18
Homologene: 17644
Rffl
Name: ring finger and FYVE like domain containing protein
Synonyms: Carp2, fring, Carp-2, 4930516L10Rik, 1700051E09Rik, rififylin
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67338
Homologene: 12116
Brap
Name: BRCA1 associated protein
Synonyms: 3010002G07Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72399
HGNC: HGNC:1099
Homologene: 4926
Snapc1
Name: small nuclear RNA activating complex, polypeptide 1
Synonyms: 9630050P21Rik, 2700033G17Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 75627
VEGA: 12
Homologene: 2317
Ehmt2
Name: euchromatic histone lysine N-methyltransferase 2
Synonyms: G9a, NG36, Bat8, D17Ertd710e, KMT1C
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 110147
Homologene: 48460
Ier5
Name: immediate early response 5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15939
HGNC: HGNC:5393
Homologene: 7778
Arcn1
Name: archain 1
Synonyms: 4632432M07Rik, pale coat neuro, nur17, delta-COP
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 213827
HGNC: HGNC:649
Homologene: 1250
Tfap2a
Name: transcription factor AP-2, alpha
Synonyms: AP-2 alpha, Tcfap2a, Ap2tf, Ap2, AP2alpha, Ap-2 (a)
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 21418
VEGA: 13
Homologene: 2421
Rb1
Name: RB transcriptional corepressor 1
Synonyms: Rb-1, pRb, Rb, retinoblastoma 1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19645
HGNC: HGNC:9884
Homologene: 272
Yy1
Name: YY1 transcription factor
Synonyms: UCRBP transcription factor, NF-E1, delta transcription factor, Yin Yang 1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 22632
Homologene: 2556
Retreg3
Name: reticulophagy regulator family member 3
Synonyms: 1300010M03Rik, Fam134c, 4933404C01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67998
Homologene: 23585
Dync2i1
Name: dynein 2 intermediate chain 1
Synonyms: Wdr60, D430033N04Rik, Dync2l1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217935
VEGA: 12
Homologene: 23067
Rlbp1
Name: retinaldehyde binding protein 1
Synonyms: 3110056M11Rik, CRALBP
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19771
Homologene: 68046
Igkc
Name: immunoglobulin kappa constant
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16071
HGNC: HGNC:5716
Sp9
Name: trans-acting transcription factor 9
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381373
Homologene: 66935
Dnah6
Name: dynein, axonemal, heavy chain 6
Synonyms: Dnahc6, A730004I20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330355
HGNC: HGNC:2951
Homologene: 15221
Pik3c2g
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18705
HGNC: HGNC:8973
Homologene: 3362
Or52e3
Name: olfactory receptor family 52 subfamily E member 3
Synonyms: Olfr594, GA_x6K02T2PBJ9-5935234-5936169, MOR32-10
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258246
Homologene: 17480
Prdm1
Name: PR domain containing 1, with ZNF domain
Synonyms: Blimp1, Blimp-1, PRDI-BF1, b2b1765Clo
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12142
HGNC: HGNC:9346
Homologene: 925
Chrd
Name: chordin
Synonyms: Chd
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12667
HGNC: HGNC:1949
Homologene: 2774
Vmn2r15
Name: vomeronasal 2, receptor 15
Synonyms: EG211223
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 211223
Homologene: 129606
Slc17a3
Name: solute carrier family 17 (sodium phosphate), member 3
Synonyms: Npt4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105355
Homologene: 21319
Crybg1
Name: crystallin beta-gamma domain containing 1
Synonyms: Aim1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11630
HGNC: HGNC:356
Homologene: 18168
Pdk2
Name: pyruvate dehydrogenase kinase, isoenzyme 2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18604
HGNC: HGNC:8810
Homologene: 68265
Col4a1
Name: collagen, type IV, alpha 1
Synonyms: Del(8)44H, Raw, Svc, Bru, alpha1(IV) collagen, Del(8)Bru44H, Col4a-1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12826
HGNC: HGNC:2202
Homologene: 20437
Cfap65
Name: cilia and flagella associated protein 65
Synonyms: B230363K08Rik, Ccdc108
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241116
Homologene: 28093
Klra2
Name: killer cell lectin-like receptor, subfamily A, member 2
Synonyms: Ly49b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16633
Homologene: 133782
Spag17
Name: sperm associated antigen 17
Synonyms: PF6, 4931427F14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74362
Homologene: 52601
Pkd1l2
Name: polycystic kidney disease 1 like 2
Synonyms: 1700126L06Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76645
Homologene: 124481
Ankdd1a
Name: ankyrin repeat and death domain containing 1A
Synonyms: EG330963, LOC384945
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 330963
VEGA: 9
Homologene: 65619
Hrnr
Name: hornerin
Synonyms: S100a18, A530063N20Rik, 1110033K19Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68723
Homologene: 138092
Actr6
Name: ARP6 actin-related protein 6
Synonyms: ArpX, 2010200J04Rik, CDA12, Arp6
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67019
VEGA: 10
Homologene: 6451
Cenpb
Name: centromere protein B
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12616
HGNC: HGNC:1852
Homologene: 1370
Kcnh1
Name: potassium voltage-gated channel, subfamily H (eag-related), member 1
Synonyms: Eag1, ether a go-go, Kv10.1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16510
HGNC: HGNC:6250
Homologene: 68242
Myorg
Name: myogenesis regulating glycosidase (putative)
Synonyms: NET37, AI464131
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329828
Homologene: 19853
Adam29
Name: a disintegrin and metallopeptidase domain 29
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244486
HGNC: HGNC:207
Homologene: 8607
Or7g16
Name: olfactory receptor family 7 subfamily G member 16
Synonyms: MOR149-1, GA_x6K02T2PVTD-12559294-12558356, Olfr828
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258598
HGNC: HGNC:8466
Homologene: 133690
B3gntl1
Name: UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1
Synonyms: 6030413G23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 210004
Homologene: 14460
Ces1b
Name: carboxylesterase 1B
Synonyms: Gm5158
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382044
HGNC: HGNC:1863
Homologene: 117484
Vmn1r23
Name: vomeronasal 1 receptor 23
Synonyms: V1rc24
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171197
Homologene: 110825
Zfp62
Name: zinc finger protein 62
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22720
Homologene: 40686
Pccb
Name: propionyl Coenzyme A carboxylase, beta polypeptide
Synonyms: 1300012P06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66904
HGNC: HGNC:8654
Homologene: 447
Cyp2f2
Name: cytochrome P450, family 2, subfamily f, polypeptide 2
Synonyms: Cyp2f
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13107
Homologene: 73898
Lyve1
Name: lymphatic vessel endothelial hyaluronan receptor 1
Synonyms: Lyve-1, Xlkd1, lymphatic vessel endothelial HA receptor-1, 1200012G08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 114332
Homologene: 4868
Col25a1
Name: collagen, type XXV, alpha 1
Synonyms: 2700062B08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77018
Homologene: 57111
Ugt3a1
Name: UDP glycosyltransferases 3 family, polypeptide A1
Synonyms: Ugt3a2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223337
Homologene: 122787
Or4n4
Name: olfactory receptor family 4 subfamily N member 4
Synonyms: GA_x6K02T2PMLR-5975274-5974348, Olfr732, MOR241-1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258659
Homologene: 72012
Plppr2
Name: phospholipid phosphatase related 2
Synonyms: Lppr2, BC018242, PRG-4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235044
Homologene: 11229
Fgl1
Name: fibrinogen-like protein 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234199
HGNC: HGNC:3695
Homologene: 37927
Tacc3
Name: transforming, acidic coiled-coil containing protein 3
Synonyms: Aint, Arnt interacting protein
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 21335
Homologene: 81618
Or4c11c
Name: olfactory receptor family 4 subfamily C member 11C
Synonyms: MOR230-3, Olfr1205, Olfr1203, MOR230-1, GA_x6K02T2Q125-50304328-50305251, GA_x6K02T2Q125-50336588-50337313
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258898
Homologene: 81567
Napa
Name: N-ethylmaleimide sensitive fusion protein attachment protein alpha
Synonyms: a-SNAP, SNARE, hyh, 1500039N14Rik, SNAPA, RA81
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 108124
HGNC: HGNC:7641
Homologene: 2839
Krtap4-9
Name: keratin associated protein 4-9
Synonyms: OTTMUSG00000002198
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 665998
Or5k16
Name: olfactory receptor family 5 subfamily K member 16
Synonyms: Olfr1563-ps1, MOR184-11P, MOR184-11P, Olfr180, GA_x54KRFPKG5P-55134972-55134019, MOR184-9
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258178
Homologene: 79337
Vmn1r158
Name: vomeronasal 1 receptor 158
Synonyms: Gm16455
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043067
Homologene: 104166
Kcnn1
Name: potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1
Synonyms: SK1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 84036
HGNC: HGNC:6290
Homologene: 37595
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 74,903,223 bp
  • G to A, chromosome 1 at 155,098,970 bp
  • G to A, chromosome 1 at 192,221,414 bp
  • T to C, chromosome 2 at 73,273,675 bp
  • T to C, chromosome 2 at 88,831,912 bp
  • A to G, chromosome 2 at 131,178,402 bp
  • G to A, chromosome 3 at 34,054,281 bp
  • T to C, chromosome 3 at 89,757,150 bp
  • A to G, chromosome 3 at 93,332,136 bp
  • A to T, chromosome 3 at 99,982,422 bp
  • T to C, chromosome 3 at 104,461,677 bp
  • A to T, chromosome 3 at 130,560,817 bp
  • T to C, chromosome 4 at 41,498,812 bp
  • T to A, chromosome 4 at 56,835,374 bp
  • T to A, chromosome 5 at 33,666,685 bp
  • A to T, chromosome 5 at 109,287,008 bp
  • T to C, chromosome 5 at 121,684,461 bp
  • A to T, chromosome 6 at 57,926,367 bp
  • T to G, chromosome 6 at 70,726,518 bp
  • T to A, chromosome 6 at 73,032,563 bp
  • T to A, chromosome 6 at 131,220,235 bp
  • G to A, chromosome 6 at 139,768,710 bp
  • A to G, chromosome 7 at 16,112,626 bp
  • A to G, chromosome 7 at 22,790,350 bp
  • A to T, chromosome 7 at 27,132,570 bp
  • A to G, chromosome 7 at 79,375,956 bp
  • A to T, chromosome 7 at 103,220,239 bp
  • G to T, chromosome 7 at 110,853,792 bp
  • A to G, chromosome 7 at 130,674,691 bp
  • A to G, chromosome 8 at 11,245,916 bp
  • T to A, chromosome 8 at 41,197,331 bp
  • A to G, chromosome 8 at 55,872,624 bp
  • C to T, chromosome 8 at 70,852,653 bp
  • C to A, chromosome 8 at 93,060,320 bp
  • C to T, chromosome 8 at 93,060,321 bp
  • A to G, chromosome 8 at 116,999,921 bp
  • A to G, chromosome 9 at 18,815,623 bp
  • TCGCC to TC, chromosome 9 at 21,944,431 bp
  • T to C, chromosome 9 at 44,743,962 bp
  • A to T, chromosome 9 at 65,508,140 bp
  • A to T, chromosome 9 at 100,985,167 bp
  • T to C, chromosome 10 at 44,003,432 bp
  • A to T, chromosome 10 at 44,439,753 bp
  • C to T, chromosome 10 at 62,559,712 bp
  • C to T, chromosome 10 at 89,714,979 bp
  • A to G, chromosome 11 at 49,216,411 bp
  • T to A, chromosome 11 at 79,547,138 bp
  • A to G, chromosome 11 at 82,810,038 bp
  • A to T, chromosome 11 at 95,032,513 bp
  • T to C, chromosome 11 at 99,785,628 bp
  • A to G, chromosome 11 at 101,102,026 bp
  • A to T, chromosome 11 at 121,630,864 bp
  • T to A, chromosome 12 at 16,965,654 bp
  • T to C, chromosome 12 at 73,975,038 bp
  • CGGCGACCACGGCGGCGGCGGGGGCG to CGGCG, chromosome 12 at 108,793,580 bp
  • A to G, chromosome 12 at 116,229,614 bp
  • C to A, chromosome 13 at 23,855,592 bp
  • A to T, chromosome 13 at 40,717,353 bp
  • GGTG to GGTGTG, chromosome 13 at 56,251,285 bp
  • A to G, chromosome 14 at 50,281,779 bp
  • A to G, chromosome 14 at 73,265,560 bp
  • A to G, chromosome 15 at 9,367,259 bp
  • A to T, chromosome 16 at 20,734,520 bp
  • T to A, chromosome 16 at 58,915,885 bp
  • C to A, chromosome 17 at 34,908,513 bp
  • A to G, chromosome 18 at 14,627,287 bp
  • T to C, chromosome 18 at 76,137,119 bp
  • A to G, chromosome 18 at 84,960,075 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8809 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068645-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.