Strain Name:
C57BL/6J-MtgxR8981Btlr/Mmmh
Stock Number:
068814-MU
Citation ID:
RRID:MMRRC_068814-MU
Other Names:
R8981 (G1)
Major Collection:

Strain Information

Rptor
Name: regulatory associated protein of MTOR, complex 1
Synonyms: Rap, 4932417H02Rik, raptor
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74370
Homologene: 80210
Mcoln3
Name: mucolipin 3
Synonyms: Va, TRPML3, varitint-waddler, 6720490O21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 171166
Homologene: 10118
Mthfr
Name: methylenetetrahydrofolate reductase
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17769
HGNC: HGNC:7436
Homologene: 4349
Mad1l1
Name: MAD1 mitotic arrest deficient 1-like 1
Synonyms: Mad1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17120
HGNC: HGNC:6762
Homologene: 74500
Ipo11
Name: importin 11
Synonyms: 2510001A17Rik, Ranbp11, 1700081H05Rik, E330021B14Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76582
Homologene: 7089
Pogz
Name: pogo transposable element with ZNF domain
Synonyms: 9530006B08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229584
Homologene: 9022
Vrk1
Name: vaccinia related kinase 1
Synonyms: 51PK
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 22367
VEGA: 12
Homologene: 2541
Resf1
Name: retroelement silencing factor 1
Synonyms: GET, 2810474O19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67246
Homologene: 19251
Arrdc3
Name: arrestin domain containing 3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105171
Homologene: 69318
Fgd6
Name: FYVE, RhoGEF and PH domain containing 6
Synonyms: ZFYVE24, Etohd4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13998
Homologene: 14209
Ecpas
Name: Ecm29 proteasome adaptor and scaffold
Synonyms: AI314180
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230249
Homologene: 6056
Susd1
Name: sushi domain containing 1
Synonyms: Gm12528
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 634731
Homologene: 11204
Fcrl2
Name: Fc receptor like 2
Synonyms: 2810439C17Rik, IFGP2, Msr2, Fcrls, Fcrh2, moFcRH2sc
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80891
Homologene: 57117
Exosc7
Name: exosome component 7
Synonyms: 2610002K22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66446
Homologene: 8994
Dcun1d5
Name: defective in cullin neddylation 1 domain containing 5
Synonyms: 3110001A18Rik, D430047L21Rik, DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae), 4833420K19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 76863
VEGA: 9
Homologene: 9028
Vac14
Name: Vac14 homolog (S. cerevisiae)
Synonyms: Trx, D8Wsu151e, ingls, Tax1bp2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234729
Homologene: 6528
Ric3
Name: RIC3 acetylcholine receptor chaperone
Synonyms: E130307J04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320360
Homologene: 49772
Or2d3b
Name: olfactory receptor family 2 subfamily D member 3B
Synonyms: MOR260-6P, Olfr1532-ps1, MOR260-9P, GA_x6K02T2PBJ9-9297671-9298594, MOR260-9P, Olfr1532, Olfr708
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258173
Homologene: 133899
Phf11c
Name: PHD finger protein 11C
Synonyms: Gm6907
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 628705
Homologene: 87807
Mprip
Name: myosin phosphatase Rho interacting protein
Synonyms: Rhoip3, RIP3, Gm34094, p116 Rho interacting protein, p116Rip
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 26936
Homologene: 9034
Adam34
Name: a disintegrin and metallopeptidase domain 34
Synonyms: testase 4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 252866
Homologene: 78104
Gne
Name: glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase
Synonyms: 2310066H07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 50798
Homologene: 3996
Myom1
Name: myomesin 1
Synonyms: D430047A17Rik, skelemin
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17929
VEGA: 17
HGNC: HGNC:7613
Homologene: 31196
Ces1d
Name: carboxylesterase 1D
Synonyms: Ces3, TGH
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 104158
HGNC: HGNC:1863
Homologene: 35606
Ugt3a2
Name: UDP glycosyltransferases 3 family, polypeptide A2
Synonyms: Ugt3a, Ugt3a1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105887
Homologene: 122787
Ppip5k1
Name: diphosphoinositol pentakisphosphate kinase 1
Synonyms: B430315C20Rik, Hisppd2a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 327655
Homologene: 49395
Thsd7b
Name: thrombospondin, type I, domain containing 7B
Synonyms: 1700074E13Rik, D130067I03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210417
Homologene: 18180
Myorg
Name: myogenesis regulating glycosidase (putative)
Synonyms: AI464131, NET37
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329828
Homologene: 19853
Spata31f1a
Name: spermatogenesis associated 31 subfamily F member 1A
Synonyms: Gm12429, Fam205a1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 433698
Homologene: 79022
Adarb2
Name: adenosine deaminase, RNA-specific, B2
Synonyms: Adar3, RED2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 94191
HGNC: HGNC:227
Homologene: 10276
Slc40a1
Name: solute carrier family 40 (iron-regulated transporter), member 1
Synonyms: Slc11a3, Dusg, metal transporting protein 1, MTP1, Ol5, Pcm, ferroportin1, IREG1, FPN1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 53945
Homologene: 40959
Cyp2j13
Name: cytochrome P450, family 2, subfamily j, polypeptide 13
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230459
HGNC: HGNC:2634
Homologene: 138297
Vmn1r220
Name: vomeronasal 1 receptor 220
Synonyms: V1rh12
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171271
Homologene: 110880
Mup15
Name: major urinary protein 15
Synonyms: Gm2068
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100039150
Homologene: 74304
C1qb
Name: complement component 1, q subcomponent, beta polypeptide
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12260
HGNC: HGNC:1242
Homologene: 418
Ccdc86
Name: coiled-coil domain containing 86
Synonyms: 6720480F16Rik, cyclon, 4933411H20Rik, D19Ertd678e
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 108673
Homologene: 41531
Slfn14
Name: schlafen 14
Synonyms: Slfn14-ps, LOC237890
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237890
Homologene: 19082
Or10ag55-ps1
Name: olfactory receptor family 10 subfamily AG member 55, pseudogene 1
Synonyms: MOR264-10P, GA_x6K02T2Q125-48769330-48770299, MOR264-27_p, Olfr1117-ps1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258110
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 45,909,420 bp
  • T to C, chromosome 1 at 129,595,450 bp
  • T to C, chromosome 2 at 87,285,217 bp
  • C to T, chromosome 2 at 121,327,640 bp
  • T to C, chromosome 3 at 87,257,370 bp
  • T to A, chromosome 3 at 94,878,915 bp
  • A to G, chromosome 3 at 146,121,799 bp
  • T to C, chromosome 4 at 41,498,209 bp
  • T to C, chromosome 4 at 42,849,354 bp
  • T to C, chromosome 4 at 44,042,261 bp
  • T to A, chromosome 4 at 58,801,796 bp
  • A to G, chromosome 4 at 59,380,883 bp
  • A to T, chromosome 4 at 61,439,588 bp
  • T to A, chromosome 4 at 96,077,290 bp
  • T to C, chromosome 4 at 136,880,722 bp
  • T to A, chromosome 4 at 143,897,076 bp
  • A to T, chromosome 4 at 148,054,994 bp
  • T to C, chromosome 5 at 140,315,058 bp
  • G to A, chromosome 6 at 149,326,499 bp
  • T to C, chromosome 7 at 106,914,383 bp
  • T to C, chromosome 7 at 109,057,836 bp
  • T to A, chromosome 8 at 43,650,803 bp
  • A to G, chromosome 8 at 93,192,829 bp
  • A to G, chromosome 8 at 110,711,594 bp
  • T to A, chromosome 9 at 7,189,205 bp
  • T to C, chromosome 9 at 123,113,300 bp
  • A to G, chromosome 10 at 94,045,054 bp
  • A to G, chromosome 11 at 59,731,557 bp
  • A to T, chromosome 11 at 83,283,629 bp
  • T to G, chromosome 11 at 119,843,682 bp
  • C to T, chromosome 12 at 106,070,694 bp
  • C to T, chromosome 13 at 8,701,617 bp
  • C to A, chromosome 13 at 23,184,253 bp
  • A to G, chromosome 13 at 80,890,550 bp
  • A to T, chromosome 13 at 106,925,125 bp
  • G to A, chromosome 14 at 59,390,963 bp
  • T to G, chromosome 15 at 9,311,928 bp
  • A to G, chromosome 17 at 71,084,321 bp
  • CCTCTGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCTGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGA to CCTCTGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGACAGGGCGATCCGGGGCTCGTCTCCGGCTGAGGTCCGGGAGACGGAAGGCTCAGTGGTGGA, chromosome 19 at 10,948,798 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8981 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068814-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.