Strain Name:
C57BL/6J-MtgxR9027Btlr/Mmmh
Stock Number:
068856-MU
Citation ID:
RRID:MMRRC_068856-MU
Other Names:
R9027 (G1)
Major Collection:

Strain Information

Psen2
Name: presenilin 2
Synonyms: PS-2, PS2, ALG-3, Ad4h
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19165
HGNC: HGNC:9509
Homologene: 386
Slc12a8
Name: solute carrier family 12 (potassium/chloride transporters), member 8
Synonyms: E330020C02Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 171286
Homologene: 11628
Cdk19
Name: cyclin dependent kinase 19
Synonyms: 2700084L06Rik, Cdc2l6
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 78334
VEGA: 10
Homologene: 22862
Dmtn
Name: dematin actin binding protein
Synonyms: dematin, Epb4.9
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13829
VEGA: 14
HGNC: HGNC:3382
Homologene: 1496
Arl1
Name: ADP-ribosylation factor-like 1
Synonyms: 2310008D22Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 104303
HGNC: HGNC:692
Homologene: 20319
Ccz1
Name: CCZ1 vacuolar protein trafficking and biogenesis associated
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231874
Homologene: 56717
Vapb
Name: vesicle-associated membrane protein, associated protein B and C
Synonyms: VAMP-associated protein 33b, VAP33b, D2Abb2e
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56491
Homologene: 36163
Sugt1
Name: SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae)
Synonyms: SGT1, 2410174K12Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67955
VEGA: 14
Homologene: 4877
Tbc1d5
Name: TBC1 domain family, member 5
Synonyms: 1600014N05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72238
VEGA: 17
Homologene: 8834
Huwe1
Name: HECT, UBA and WWE domain containing 1
Synonyms: C430014N20Rik, 5430439H10Rik, Ib772, Ureb1, Arf-bp1, Mule, LOC382250
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 59026
Homologene: 45994
Dars1
Name: aspartyl-tRNA synthetase 1
Synonyms: 5730439G15Rik, Dars
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226414
HGNC: HGNC:2678
Homologene: 1032
Socs6
Name: suppressor of cytokine signaling 6
Synonyms: 5830401B18Rik, SOCS-4, CIS4, SOCS-6, HSPC060, STATI4, Socs4, Cish4, SSI4, STAT4, 1500012M23Rik, STAI4
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 54607
Homologene: 3120
Slc25a46
Name: solute carrier family 25, member 46
Synonyms: 1200007B05Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67453
VEGA: 18
Homologene: 14518
Gpr3
Name: G-protein coupled receptor 3
Synonyms: Gpcr3, Gpcr21
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14748
HGNC: HGNC:4484
Homologene: 31303
Tbc1d1
Name: TBC1 domain family, member 1
Synonyms: Nob1, 1110062G02Rik, Nobq1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 57915
Homologene: 56856
Six6
Name: sine oculis-related homeobox 6
Synonyms: Six9, Optx2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20476
Homologene: 7220
Clca4b
Name: chloride channel accessory 4B
Synonyms: AI747448
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99709
HGNC: HGNC:2018
Homologene: 40808
Crmp1
Name: collapsin response mediator protein 1
Synonyms: DRP-1, Ulip3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12933
HGNC: HGNC:2365
Homologene: 20347
Socs2
Name: suppressor of cytokine signaling 2
Synonyms: CIS2, JAB, SOCS-2, cytokine-inducible SH2 protein 2, Cish2, STAT-induced STAT inhibitor 2, D130043N08Rik, SSI-2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216233
Homologene: 2880
Zcrb1
Name: zinc finger CCHC-type and RNA binding motif 1
Synonyms: 2700088M22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67197
Homologene: 12095
Atad2
Name: ATPase family, AAA domain containing 2
Synonyms: 2610509G12Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70472
VEGA: 15
Homologene: 6044
Usp42
Name: ubiquitin specific peptidase 42
Synonyms: D5Ertd591e, 3110031A07Rik, A630018G05Rik, 2410140K03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76800
Homologene: 35425
Fancm
Name: Fanconi anemia, complementation group M
Synonyms: C730036B14Rik, D12Ertd364e
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104806
VEGA: 12
Homologene: 35378
Spryd3
Name: SPRY domain containing 3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223918
Homologene: 13138
Alox12e
Name: arachidonate lipoxygenase, epidermal
Synonyms: Alox12-ps1, e-LOX1, Alox12-ps2, Aloxe, 8-LOX
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11685
Homologene: 105868
Lama2
Name: laminin, alpha 2
Synonyms: merosin, mer
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16773
HGNC: HGNC:6482
Homologene: 37306
Arhgap20
Name: Rho GTPase activating protein 20
Synonyms: A530023E23Rik, 6530403F17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244867
Homologene: 18938
Chrd
Name: chordin
Synonyms: Chd
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12667
HGNC: HGNC:1949
Homologene: 2774
Vwf
Name: Von Willebrand factor
Synonyms: B130011O06Rik, 6820430P06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22371
Homologene: 466
Synm
Name: synemin, intermediate filament protein
Synonyms: Synemin, 4930412K21Rik, Dmn
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233335
Homologene: 9081
Ahnak
Name: AHNAK nucleoprotein
Synonyms: 1110004P15Rik, DY6, 2310047C17Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66395
VEGA: 19
HGNC: HGNC:347
Homologene: 67425
Stxbp5l
Name: syntaxin binding protein 5-like
Synonyms: tomosyn-2, A830015P08Rik, T2dm1, LLGL4, t2md1, insulin level locus 1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207227
Homologene: 18173
Tulp4
Name: TUB like protein 4
Synonyms: 1110057P05Rik, 2210038L17Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68842
Homologene: 32467
Vmn1r228
Name: vomeronasal 1 receptor 228
Synonyms: V1re3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 171226
Homologene: 74320
Tlr11
Name: toll-like receptor 11
Synonyms: LOC239081
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239081
Homologene: 77905
Speg
Name: SPEG complex locus
Synonyms: SPEGbeta, BPEG, SPEGalpha, Apeg1, SPEG, D1Bwg1450e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11790
Homologene: 55619
Sytl2
Name: synaptotagmin-like 2
Synonyms: Slp2-d, Slp2-a, Slp2, Slp2-b, Slp2-c
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 83671
Homologene: 131343
Ms4a20
Name: membrane-spanning 4-domains, subfamily A, member 20
Synonyms: 1700017D01Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 69369
Nfasc
Name: neurofascin
Synonyms: D430023G06Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269116
Homologene: 24945
Gabrg3
Name: gamma-aminobutyric acid type A receptor, subunit gamma 3
Synonyms: B230362M20Rik, Gabrg-3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14407
HGNC: HGNC:4088
Homologene: 22444
Sry
Name: sex determining region of Chr Y
Synonyms: Tdy, Tdf
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 21674
Klhl33
Name: kelch-like 33
Synonyms: EG546611
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 546611
VEGA: 14
Homologene: 52385
C130050O18Rik
Name: RIKEN cDNA C130050O18 gene
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319772
Homologene: 138442
Spata31e4
Name: spermatogenesis associated 31 subfamily E member 4
Synonyms: Gm8765
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 667693
Homologene: 134512
Ints5
Name: integrator complex subunit 5
Synonyms: 1110055N21Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 109077
Homologene: 35303
Plcd1
Name: phospholipase C, delta 1
Synonyms: PLC-delta 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18799
VEGA: 9
HGNC: HGNC:9060
Homologene: 21252
Cr2
Name: complement receptor 2
Synonyms: Cr1, C3DR, CD21, Cr-2, Cr-1, CD35
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12902
HGNC: HGNC:2336
Homologene: 55611
Mks1
Name: MKS transition zone complex subunit 1
Synonyms: avc6, Meckel syndrome, type 1, B8d3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380718
HGNC: HGNC:7121
Homologene: 9833
Rragd
Name: Ras-related GTP binding D
Synonyms: C030003H22Rik, 5730543C08Rik, D4Ertd174e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 52187
Homologene: 49667
Selenoi
Name: selenoprotein I
Synonyms: Ept1, 4933402G07Rik, D5Wsu178e, C79563
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 28042
Homologene: 100935
Pbx4
Name: pre B cell leukemia homeobox 4
Synonyms: 2410015M21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 80720
Homologene: 57027
Plk5
Name: polo like kinase 5
Synonyms: 6330514A18Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216166
Homologene: 28072
Cpa5
Name: carboxypeptidase A5
Synonyms: 4930430M09Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74649
Homologene: 62246
Jhy
Name: junctional cadherin complex regulator
Synonyms: 4931429I11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70989
Homologene: 11726
Vmn2r33
Name: vomeronasal 2, receptor 33
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 624512
Homologene: 113703
Wdr81
Name: WD repeat domain 81
Synonyms: nur5, shakey 5, MGC32441
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192652
Homologene: 13983
Rsph14
Name: radial spoke head homolog 14 (Chlamydomonas)
Synonyms: Rtdr1, 4933431K05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71236
Homologene: 49382
Btbd7
Name: BTB domain containing 7
Synonyms: FUP1, E130118E17Rik, 5730507E09Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238386
VEGA: 12
Homologene: 34300
Or2a57
Name: olfactory receptor family 2 subfamily A member 57
Synonyms: GA_x6K02T2P3E9-4322325-4321360, IB12, MOR261-9, Olfr47
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18346
Homologene: 133700
Tspan4
Name: tetraspanin 4
Synonyms: NAG-2, Tspan-4, Tm4sf7, novel antigen 2, D130042I01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 64540
Homologene: 2453
Adam1b
Name: a disintegrin and metallopeptidase domain 1b
Synonyms: PH-30 alpha, fertilin alpha, Ftna
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 280667
Homologene: 136485
Or51g2
Name: olfactory receptor family 51 subfamily G member 2
Synonyms: GA_x6K02T2PBJ9-5685322-5684384, Olfr577, MOR7-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259113
Homologene: 64962
Vmn2r34
Name: vomeronasal 2, receptor 34
Synonyms: ENSMUSG00000070841
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100042636
Homologene: 113703
Or4k50-ps1
Name: olfactory receptor family 4 subfamily K member 50, pseudogene 1
Synonyms: MOR248-12, GA_x6K02T2Q125-72742960-72743875, Olfr1300-ps1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258199
Ermardl1
Name: ER membrane associated RNA degradation like 1
Synonyms: Gm3435
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100041621
VEGA: 17
Homologene: 104886
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 75,388,432 bp
  • A to T, chromosome 1 at 128,368,426 bp
  • T to A, chromosome 1 at 132,611,605 bp
  • C to A, chromosome 1 at 180,229,407 bp
  • A to T, chromosome 1 at 195,151,721 bp
  • A to T, chromosome 2 at 111,692,172 bp
  • A to G, chromosome 2 at 173,776,155 bp
  • G to A, chromosome 3 at 144,912,066 bp
  • G to A, chromosome 4 at 32,996,083 bp
  • A to T, chromosome 4 at 133,210,898 bp
  • C to T, chromosome 5 at 30,232,609 bp
  • C to A, chromosome 5 at 37,280,603 bp
  • T to C, chromosome 5 at 64,257,006 bp
  • C to A, chromosome 5 at 121,502,725 bp
  • A to G, chromosome 5 at 139,414,546 bp
  • G to A, chromosome 5 at 143,723,151 bp
  • A to C, chromosome 5 at 144,009,302 bp
  • G to T, chromosome 6 at 30,612,605 bp
  • T to C, chromosome 6 at 43,236,424 bp
  • G to T, chromosome 6 at 125,666,663 bp
  • A to G, chromosome 7 at 7,551,169 bp
  • A to T, chromosome 7 at 7,672,528 bp
  • T to A, chromosome 7 at 56,773,374 bp
  • T to C, chromosome 7 at 67,734,692 bp
  • A to G, chromosome 7 at 90,379,540 bp
  • T to C, chromosome 7 at 102,973,353 bp
  • T to C, chromosome 7 at 141,489,664 bp
  • T to A, chromosome 8 at 69,864,349 bp
  • A to T, chromosome 9 at 40,917,527 bp
  • A to T, chromosome 9 at 51,843,677 bp
  • T to C, chromosome 9 at 119,084,641 bp
  • A to T, chromosome 10 at 27,204,885 bp
  • A to G, chromosome 10 at 40,479,732 bp
  • A to T, chromosome 10 at 74,959,591 bp
  • C to G, chromosome 10 at 80,357,996 bp
  • A to G, chromosome 10 at 88,733,596 bp
  • A to T, chromosome 10 at 95,413,086 bp
  • A to G, chromosome 11 at 70,321,774 bp
  • T to C, chromosome 11 at 75,442,082 bp
  • A to T, chromosome 11 at 75,452,381 bp
  • C to A, chromosome 11 at 87,857,215 bp
  • C to A, chromosome 12 at 65,075,831 bp
  • T to C, chromosome 12 at 72,940,161 bp
  • T to G, chromosome 12 at 102,838,579 bp
  • C to T, chromosome 13 at 50,702,971 bp
  • G to A, chromosome 14 at 50,361,292 bp
  • G to A, chromosome 14 at 50,892,865 bp
  • A to G, chromosome 14 at 70,616,115 bp
  • A to G, chromosome 14 at 79,587,715 bp
  • T to C, chromosome 15 at 58,132,232 bp
  • A to G, chromosome 15 at 93,387,575 bp
  • A to G, chromosome 15 at 102,119,408 bp
  • A to G, chromosome 16 at 20,736,987 bp
  • T to C, chromosome 16 at 33,624,845 bp
  • T to C, chromosome 16 at 37,345,111 bp
  • T to A, chromosome 17 at 6,233,197 bp
  • A to G, chromosome 17 at 15,022,102 bp
  • T to C, chromosome 17 at 20,777,160 bp
  • C to A, chromosome 17 at 50,756,664 bp
  • A to G, chromosome 18 at 31,583,379 bp
  • T to C, chromosome 18 at 88,870,728 bp
  • C to A, chromosome 19 at 8,895,958 bp
  • T to G, chromosome 19 at 9,007,253 bp
  • A to T, chromosome 19 at 11,105,691 bp
  • G to A, chromosome X at 151,933,088 bp
  • GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG to GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG, chromosome Y at 2,662,638 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9027 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068856-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.