Strain Name:
C57BL/6J-MtgxR9094Btlr/Mmmh
Stock Number:
068909-MU
Citation ID:
RRID:MMRRC_068909-MU
Other Names:
R9094 (G1)
Major Collection:

Strain Information

Sez6
Name: seizure related gene 6
Synonyms: sez-6, D11Bhm177e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20370
Homologene: 10948
Utp20
Name: UTP20 small subunit processome component
Synonyms: DRIM, 3830408P06Rik, mDRIM
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70683
VEGA: 10
Homologene: 38373
Npy5r
Name: neuropeptide Y receptor Y5
Synonyms: Y5R
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18168
HGNC: HGNC:7958
Homologene: 21241
Mllt1
Name: myeloid/lymphoid or mixed-lineage leukemia; translocated to, 1
Synonyms: LTG19, ENL, BAM11
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 64144
VEGA: 17
HGNC: HGNC:7134
Homologene: 4339
Rgs3
Name: regulator of G-protein signaling 3
Synonyms: RGS3S, C2PA-RGS3, PDZ-RGS3, C2pa, 4930506N09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 50780
HGNC: HGNC:9999
Homologene: 32440
Ldlrad3
Name: low density lipoprotein receptor class A domain containing 3
Synonyms: Lrad3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241576
Homologene: 18377
Luzp1
Name: leucine zipper protein 1
Synonyms: 2700072H04Rik, Luzp
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269593
Homologene: 11545
Fbxo31
Name: F-box protein 31
Synonyms: Fbxo14, 1110003O08Rik, 2310046N15Rik, Fbx14
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76454
Homologene: 11684
Agrn
Name: agrin
Synonyms: nmf380, NMF380, Agrin
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11603
HGNC: HGNC:329
Homologene: 27907
Rexo1
Name: REX1, RNA exonuclease 1
Synonyms: 1700021P10Rik, Rex1, 2610511M11Rik, Tceb3bp1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66932
Homologene: 41391
Srebf2
Name: sterol regulatory element binding factor 2
Synonyms: SREBP2gc, nuc, SREBP2, bHLHd2, lop13, SREBP-2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20788
VEGA: 15
Homologene: 20966
Anln
Name: anillin, actin binding protein
Synonyms: 1110037A17Rik, Scraps, 2900037I21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68743
VEGA: 9
Homologene: 41281
Cpne1
Name: copine I
Synonyms: 1810028N16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 266692
HGNC: HGNC:2314
Homologene: 36501
Kifbp
Name: kinesin family binding protein
Synonyms: 2510003E04Rik, Kif1bp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 72320
Homologene: 9223
Rsf1
Name: remodeling and spacing factor 1
Synonyms: Hbxap, p325, XAP8, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Arb2a
Name: ARB2 cotranscriptional regulator A
Synonyms: 9430037D06Rik, pEN87, 1110033M05Rik, Fam172a, 53-E6, 2610318O14Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68675
VEGA: 13
Homologene: 12933
Rars1
Name: arginyl-tRNA synthetase 1
Synonyms: 2610011N19Rik, 2610037E21Rik, Rars
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 104458
HGNC: HGNC:9870
Homologene: 68281
Rtn4r
Name: reticulon 4 receptor
Synonyms: Nogo-66 receptor, NgR, NgR1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 65079
Homologene: 11299
Rbms2
Name: RNA binding motif, single stranded interacting protein 2
Synonyms: 2610315E04Rik, Scr3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 56516
VEGA: 10
HGNC: HGNC:9909
Homologene: 37706
Insig1
Name: insulin induced gene 1
Synonyms: 1810013C12Rik, Insig-1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231070
HGNC: HGNC:6083
Homologene: 4047
Cpa4
Name: carboxypeptidase A4
Synonyms: 1110019K20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71791
Homologene: 56753
Lrrc4
Name: leucine rich repeat containing 4
Synonyms: NGL-2, Nag14, NGL2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 192198
Homologene: 36403
Brca2
Name: breast cancer 2, early onset
Synonyms: RAB163, Fancd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12190
HGNC: HGNC:1101
Homologene: 41
Sorl1
Name: sortilin-related receptor, LDLR class A repeats-containing
Synonyms: Sorla, LR11, mSorLA, 2900010L19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20660
Homologene: 2336
Grpel1
Name: GrpE-like 1, mitochondrial
Synonyms: mt-GrpE#1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17713
Homologene: 6992
Fbxo34
Name: F-box protein 34
Synonyms: 2900057B08Rik, 5830426G16Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 78938
VEGA: 14
Homologene: 12713
Arid3b
Name: AT-rich interaction domain 3B
Synonyms: Bdp, Dri2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56380
Homologene: 4721
Slmap
Name: sarcolemma associated protein
Synonyms: D330001L02Rik, Slap, Miranda
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 83997
Homologene: 31428
Klhl20
Name: kelch-like 20
Synonyms: D930050H05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226541
Homologene: 8699
Szt2
Name: SZT2 subunit of KICSTOR complex
Synonyms: seaizure threshold 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230676
Homologene: 49413
Blnk
Name: B cell linker
Synonyms: BCA, Bca, Ly-57, BLNK, BASH, Ly57, SLP-65
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 17060
Homologene: 32038
Il16
Name: interleukin 16
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16170
HGNC: HGNC:5980
Homologene: 18157
Lrp3
Name: low density lipoprotein receptor-related protein 3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 435965
HGNC: HGNC:6695
Homologene: 1745
Peg10
Name: paternally expressed 10
Synonyms: HB-1, Edr, MyEF-3 like, MEF3L, Mart2, Rtl2, MyEF-3, Mar2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Ncoa1
Name: nuclear receptor coactivator 1
Synonyms: KAT13A, bHLHe74, SRC-1, SRC-a/NCoA-1, steroid receptor coactivator-1, SRC1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 17977
VEGA: 12
HGNC: HGNC:7668
Homologene: 7859
Frmd4b
Name: FERM domain containing 4B
Synonyms: GRSP1, 6030440G05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232288
Homologene: 14916
Il12rb1
Name: interleukin 12 receptor, beta 1
Synonyms: IL-12R[b], CD212
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16161
HGNC: HGNC:5971
Homologene: 4042
Ttf1
Name: transcription termination factor, RNA polymerase I
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22130
Homologene: 137223
Vmn2r25
Name: vomeronasal 2, receptor 25
Synonyms: EG545874
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 545874
Homologene: 135915
Bsn
Name: bassoon
Synonyms: presynaptic cytomatrix protein
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12217
HGNC: HGNC:1117
Homologene: 31161
Rev3l
Name: REV3 like, DNA directed polymerase zeta catalytic subunit
Synonyms: Sez4, Rev
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19714
HGNC: HGNC:9968
Homologene: 48147
Gjb3
Name: gap junction protein, beta 3
Synonyms: Cx31, connexin 31, Cnx31, Gjb-3, D4Wsu144e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14620
HGNC: HGNC:4285
Homologene: 7338
Cacna1e
Name: calcium channel, voltage-dependent, R type, alpha 1E subunit
Synonyms: alpha1E, Cchra1, Cav2.3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12290
HGNC: HGNC:1392
Homologene: 20185
Kctd1
Name: potassium channel tetramerisation domain containing 1
Synonyms: 4933402K10Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 106931
VEGA: 18
Homologene: 65999
Wfdc8
Name: WAP four-disulfide core domain 8
Synonyms: LOC277343
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 277343
Homologene: 33799
3425401B19Rik
Name: RIKEN cDNA 3425401B19 gene
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100504518
VEGA: 14
Homologene: 54908
Catsperg1
Name: cation channel sperm associated auxiliary subunit gamma 1
Synonyms: Catsperg, A230107C01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320225
Homologene: 10915
Ngly1
Name: N-glycanase 1
Synonyms: 1110002C09Rik, PNGase, Png1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 59007
Homologene: 10117
Abi3bp
Name: ABI family member 3 binding protein
Synonyms: TARSH, eratin, D930038M13Rik, 5033411B22Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 320712
VEGA: 16
Homologene: 134172
Bco1
Name: beta-carotene oxygenase 1
Synonyms: beta-CD, Bcdo1, Cmoi, Bcdo, Bcmo1, betaCMOOX
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 63857
Homologene: 41172
Kcnk10
Name: potassium channel, subfamily K, member 10
Synonyms: 3010005K24Rik, Trek2, 1700024D23Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 72258
VEGA: 12
HGNC: HGNC:6273
Homologene: 11321
Zfp760
Name: zinc finger protein 760
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240034
VEGA: 17
Zeb2
Name: zinc finger E-box binding homeobox 2
Synonyms: 9130203F04Rik, SIP1, Zfhx1b, Zfx1b, D130016B08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 24136
Homologene: 8868
Nelfcd
Name: negative elongation factor complex member C/D, Th1l
Synonyms: trihydrophobin 1, Th1l, 2410003I03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 57314
Homologene: 9496
Dnase1l3
Name: deoxyribonuclease 1-like 3
Synonyms: DNasegamma
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13421
HGNC: HGNC:2959
Homologene: 3630
Zfp3
Name: zinc finger protein 3
Synonyms: Fnp-1, Zfp-3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 193043
Homologene: 27406
Ube2e2
Name: ubiquitin-conjugating enzyme E2E 2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218793
Homologene: 77337
Gdpgp1
Name: GDP-D-glucose phosphorylase 1
Synonyms: D330012F22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269952
Homologene: 33436
Tbc1d24
Name: TBC1 domain family, member 24
Synonyms: C530046L02Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224617
Homologene: 27469
Rtkn
Name: rhotekin
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20166
Homologene: 7522
Pm20d1
Name: peptidase M20 domain containing 1
Synonyms: 4732466D17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 212933
Homologene: 65049
Or55b10
Name: olfactory receptor family 55 subfamily B member 10
Synonyms: GA_x6K02T2PBJ9-5216160-5215210, S50, Olfr545, MOR42-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258837
Homologene: 17410
Or5d46
Name: olfactory receptor family 5 subfamily D member 46
Synonyms: Olfr1176, MOR174-5, GA_x6K02T2Q125-49824309-49825256
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258767
Pcdha6
Name: protocadherin alpha 6
Synonyms: Cnr2, Crnr2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12937
Homologene: 75098
Duxf3
Name: double homeobox family member 3
Synonyms: 4933403O03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 74399
3110021N24Rik
Name: RIKEN cDNA 3110021N24 gene
Type: Gene
Species: Mouse
Chromosome: 4
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 131,802,743 bp
  • T to A, chromosome 1 at 154,479,318 bp
  • T to A, chromosome 1 at 161,105,485 bp
  • T to A, chromosome 2 at 29,067,068 bp
  • C to T, chromosome 2 at 45,113,124 bp
  • A to G, chromosome 2 at 88,339,904 bp
  • T to C, chromosome 2 at 102,057,981 bp
  • A to C, chromosome 2 at 156,079,160 bp
  • C to T, chromosome 2 at 164,597,325 bp
  • T to C, chromosome 2 at 174,424,068 bp
  • A to T, chromosome 4 at 62,582,003 bp
  • T to C, chromosome 4 at 108,780,547 bp
  • T to C, chromosome 4 at 118,385,454 bp
  • GCCAGATGCGCCCA to GCCAGATGCGCCCAGATGCGCCCA, chromosome 4 at 127,326,665 bp
  • A to T, chromosome 4 at 136,545,251 bp
  • C to A, chromosome 4 at 156,168,807 bp
  • T to A, chromosome 5 at 28,073,572 bp
  • A to G, chromosome 5 at 36,469,479 bp
  • T to G, chromosome 5 at 150,552,305 bp
  • GAT to GATCAT, chromosome 6 at 4,756,449 bp
  • G to A, chromosome 6 at 28,830,207 bp
  • G to T, chromosome 6 at 30,574,394 bp
  • A to T, chromosome 6 at 83,151,037 bp
  • T to C, chromosome 6 at 97,421,598 bp
  • C to T, chromosome 6 at 123,828,432 bp
  • G to C, chromosome 7 at 29,184,727 bp
  • T to C, chromosome 7 at 35,203,757 bp
  • T to A, chromosome 7 at 80,238,468 bp
  • T to C, chromosome 7 at 83,652,351 bp
  • G to GACGGCGGCC, chromosome 7 at 97,579,909 bp
  • T to C, chromosome 7 at 102,494,361 bp
  • G to A, chromosome 8 at 66,680,908 bp
  • A to G, chromosome 8 at 70,820,647 bp
  • A to C, chromosome 8 at 117,133,178 bp
  • G to A, chromosome 8 at 121,554,397 bp
  • A to G, chromosome 9 at 22,337,987 bp
  • A to T, chromosome 9 at 42,063,754 bp
  • A to G, chromosome 9 at 57,834,044 bp
  • T to A, chromosome 9 at 108,110,853 bp
  • A to T, chromosome 10 at 39,824,813 bp
  • GCCC to GCC, chromosome 10 at 58,231,122 bp
  • A to G, chromosome 10 at 62,559,258 bp
  • A to G, chromosome 10 at 80,543,020 bp
  • T to C, chromosome 10 at 88,775,318 bp
  • T to A, chromosome 10 at 128,151,238 bp
  • T to C, chromosome 11 at 35,827,355 bp
  • C to T, chromosome 11 at 70,772,415 bp
  • G to A, chromosome 11 at 77,974,295 bp
  • G to T, chromosome 12 at 4,295,494 bp
  • T to A, chromosome 12 at 98,518,516 bp
  • A to G, chromosome 13 at 78,163,606 bp
  • A to T, chromosome 14 at 7,987,306 bp
  • A to C, chromosome 14 at 16,280,721 bp
  • A to G, chromosome 14 at 18,893,288 bp
  • T to C, chromosome 14 at 26,416,200 bp
  • G to A, chromosome 14 at 32,660,657 bp
  • C to G, chromosome 14 at 47,530,471 bp
  • A to T, chromosome 15 at 82,172,774 bp
  • A to T, chromosome 16 at 18,151,844 bp
  • A to G, chromosome 16 at 56,636,227 bp
  • T to C, chromosome 17 at 21,722,951 bp
  • C to A, chromosome 17 at 24,181,300 bp
  • C to A, chromosome 17 at 56,905,737 bp
  • T to C, chromosome 18 at 15,062,312 bp
  • T to A, chromosome 18 at 36,968,540 bp
  • A to G, chromosome 19 at 40,994,039 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9094 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068909-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.