Strain Name:
C57BL/6J-MtgxR9167Btlr/Mmmh
Stock Number:
068946-MU
Citation ID:
RRID:MMRRC_068946-MU
Other Names:
R9167 (G1)
Major Collection:

Strain Information

Rest
Name: RE1-silencing transcription factor
Synonyms: NRSF, 2610008J04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19712
HGNC: HGNC:9966
Homologene: 4099
Atic
Name: 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase
Synonyms: 2610509C24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108147
HGNC: HGNC:794
Homologene: 2983
Avpr1b
Name: arginine vasopressin receptor 1B
Synonyms: V3/V1b, V1BR, VPR3, V1bR, V3/V1b pituitary vasopressin receptor, AVPR3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 26361
HGNC: HGNC:896
Homologene: 22678
Kif16b
Name: kinesin family member 16B
Synonyms: 8430434E15Rik, N-3 kinesin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16558
Homologene: 135708
Fmn2
Name: formin 2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 54418
Homologene: 137334
Taf3
Name: TATA-box binding protein associated factor 3
Synonyms: 4933439M23Rik, mTAFII140
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 209361
Homologene: 35415
Hdac4
Name: histone deacetylase 4
Synonyms: 4932408F19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 208727
Homologene: 55946
Ddx46
Name: DEAD box helicase 46
Synonyms: 8430438J23Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 46, 2200005K02Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 212880
VEGA: 13
Homologene: 5430
Herc1
Name: HECT and RLD domain containing E3 ubiquitin protein ligase family member 1
Synonyms: tbl, D130015N03Rik, 2810449H11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235439
HGNC: HGNC:4867
Homologene: 31207
Tasor2
Name: transcription activation suppressor family member 2
Synonyms: Fam208b, BC016423
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105203
VEGA: 13
Homologene: 26435
Dnah7a
Name: dynein, axonemal, heavy chain 7A
Synonyms: Dnahc7, LOC381341, Dnahc7a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 627872
Homologene: 41287
Ctla4
Name: cytotoxic T-lymphocyte-associated protein 4
Synonyms: Cd152, Ly-56, Ctla-4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12477
HGNC: HGNC:2505
Homologene: 3820
Tpm3
Name: tropomyosin 3, gamma
Synonyms: skalphaTM.2, hTMnm, hTM30nm, gamma-TM, Trop-5, Tpm5, Tpm-5, Tm5NM
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 59069
Homologene: 81889
Cul7
Name: cullin 7
Synonyms: p185, 2510004L20Rik, C230011P08Rik, p193
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66515
Homologene: 56683
Cables1
Name: CDK5 and Abl enzyme substrate 1
Synonyms: ik3-1, interactor-1 with cdk3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 63955
VEGA: 18
Homologene: 11097
Pde4a
Name: phosphodiesterase 4A, cAMP specific
Synonyms: Dpde2, D9Ertd60e, dunce
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18577
HGNC: HGNC:8780
Homologene: 4520
Cd22
Name: CD22 antigen
Synonyms: Lyb-8, Lyb8
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12483
HGNC: HGNC:1643
Homologene: 31052
Abcb4
Name: ATP-binding cassette, sub-family B member 4
Synonyms: Mdr2, Pgy-2, Pgy2, mdr-2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18670
HGNC: HGNC:45
Homologene: 136368
Lrrc37a
Name: leucine rich repeat containing 37A
Synonyms: LOC237954
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237954
Homologene: 138824
Serpinb6e
Name: serine (or cysteine) peptidase inhibitor, clade B, member 6e
Synonyms: Gm11396, ovalbumin, SPI3B
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 435350
HGNC: HGNC:8950
Homologene: 50933
Ryr3
Name: ryanodine receptor 3
Synonyms: calcium release channel isoform 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20192
Homologene: 68151
Krt73
Name: keratin 73
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223915
Homologene: 27875
Nsun7
Name: NOL1/NOP2/Sun domain family, member 7
Synonyms: 4921525L17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70918
Homologene: 11653
Acrbp
Name: proacrosin binding protein
Synonyms: sp32, OY-TES-1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54137
Homologene: 9641
Tmem266
Name: transmembrane protein 266
Synonyms: AI118078
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244886
Homologene: 17551
Nrxn3
Name: neurexin III
Synonyms: neurexin III alpha, 4933401A11Rik, neurexin III beta, neurexin III alpha, 9330112C09Rik, neurexin III beta, D12Bwg0831e
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18191
HGNC: HGNC:8010
Homologene: 83225
Aatk
Name: apoptosis-associated tyrosine kinase
Synonyms: AATYK1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11302
HGNC: HGNC:21
Homologene: 74861
Or52d1
Name: olfactory receptor family 52 subfamily D member 1
Synonyms: GA_x6K02T2PBJ9-6841330-6842268, MOR33-2, Olfr646
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259058
Homologene: 17481
Slc2a9
Name: solute carrier family 2 (facilitated glucose transporter), member 9
Synonyms: SLC2a9A, Glut9, SLC2A9B
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 117591
Homologene: 69290
Fyn
Name: Fyn proto-oncogene
Synonyms: Src Kinase p59
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14360
HGNC: HGNC:4037
Homologene: 48068
Myrfl
Name: myelin regulatory factor-like
Synonyms: LOC237558, Gm239
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237558
VEGA: 10
Homologene: 88588
Kcnt2
Name: potassium channel, subfamily T, member 2
Synonyms: E330038N15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240776
Homologene: 16121
Tlx2
Name: T cell leukemia, homeobox 2
Synonyms: Hox11L.1, Hox11l1, Ncx1, NCX, Tlx1l1, Enx
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21909
HGNC: HGNC:5057
Homologene: 7575
Cep250
Name: centrosomal protein 250
Synonyms: Cep2, Inmp, B230210E21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16328
HGNC: HGNC:1859
Homologene: 38286
Musk
Name: muscle, skeletal, receptor tyrosine kinase
Synonyms: Nsk1, Nsk2, Nsk3, MDK4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18198
HGNC: HGNC:7525
Homologene: 4084
Nlrp4e
Name: NLR family, pyrin domain containing 4E
Synonyms: Nalp-epsilon, Nalp4e, 4930406H16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 446099
Homologene: 75315
Pom121l2
Name: POM121 transmembrane nucleoporin like 2
Synonyms: LOC195236
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 195236
Homologene: 123536
Vwa2
Name: von Willebrand factor A domain containing 2
Synonyms: Amaco
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240675
Homologene: 18238
Vmn1r9
Name: vomeronasal 1 receptor 9
Synonyms: V1rc30
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171203
Homologene: 76459
Hmgcs2
Name: 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2
Synonyms: mHS
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 15360
HGNC: HGNC:5008
Homologene: 38066
Nanp
Name: N-acetylneuraminic acid phosphatase
Synonyms: Hdhd4, 1600031M04Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67311
Homologene: 12112
Zfp677
Name: zinc finger protein 677
Synonyms: A830058L05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 210503
Homologene: 138402
Kcnj15
Name: potassium inwardly-rectifying channel, subfamily J, member 15
Synonyms: Kir4.2, IRKK, 4930414N08Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16516
HGNC: HGNC:6261
Homologene: 1690
Unc93a
Name: unc-93 homolog A
Synonyms: Unc93l
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381058
Homologene: 10356
Amot
Name: angiomotin
Synonyms: Sii6, D0Kist1, E230009N18Rik
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 27494
Homologene: 15778
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 53,618,211 bp
  • C to T, chromosome 1 at 60,912,536 bp
  • T to A, chromosome 1 at 71,564,881 bp
  • G to A, chromosome 1 at 91,947,534 bp
  • T to C, chromosome 1 at 131,609,413 bp
  • A to G, chromosome 1 at 140,578,462 bp
  • G to T, chromosome 1 at 174,503,490 bp
  • A to G, chromosome 2 at 9,940,993 bp
  • A to T, chromosome 2 at 112,834,053 bp
  • A to T, chromosome 2 at 142,700,920 bp
  • A to T, chromosome 2 at 151,030,808 bp
  • A to G, chromosome 2 at 155,987,000 bp
  • T to A, chromosome 3 at 90,087,517 bp
  • T to C, chromosome 3 at 98,297,114 bp
  • A to T, chromosome 4 at 58,296,687 bp
  • T to A, chromosome 5 at 8,936,849 bp
  • T to A, chromosome 5 at 38,391,749 bp
  • G to A, chromosome 5 at 66,278,651 bp
  • GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC to GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC, chromosome 5 at 77,281,804 bp
  • A to C, chromosome 6 at 57,071,153 bp
  • T to A, chromosome 6 at 83,069,061 bp
  • T to C, chromosome 6 at 125,062,979 bp
  • A to G, chromosome 7 at 23,340,526 bp
  • G to A, chromosome 7 at 30,876,005 bp
  • A to G, chromosome 7 at 104,107,219 bp
  • T to C, chromosome 9 at 21,191,502 bp
  • A to G, chromosome 9 at 55,414,947 bp
  • A to G, chromosome 9 at 66,504,618 bp
  • T to G, chromosome 10 at 39,526,815 bp
  • A to G, chromosome 10 at 116,831,545 bp
  • T to A, chromosome 11 at 103,456,832 bp
  • C to A, chromosome 11 at 120,011,126 bp
  • T to A, chromosome 12 at 89,187,298 bp
  • A to G, chromosome 13 at 3,574,724 bp
  • C to T, chromosome 13 at 21,982,990 bp
  • A to G, chromosome 13 at 33,839,026 bp
  • T to A, chromosome 13 at 55,655,102 bp
  • A to G, chromosome 15 at 101,793,970 bp
  • A to G, chromosome 16 at 95,295,882 bp
  • T to C, chromosome 17 at 13,116,221 bp
  • T to C, chromosome 17 at 21,393,198 bp
  • A to G, chromosome 17 at 46,655,697 bp
  • T to C, chromosome 18 at 11,905,972 bp
  • T to A, chromosome 19 at 56,910,631 bp
  • A to T, chromosome X at 145,461,749 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9167 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068946-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.