Strain Name:
C57BL/6J-MtgxR0238Btlr/Mmmh
Stock Number:
038476-MU
Citation ID:
RRID:MMRRC_038476-MU
Other Names:
R0238 (G1), C57BL/6J-MtgxR0238Btlr
Major Collection:

Gene Information

Tnrc6b
Name: trinucleotide repeat containing 6b
Synonyms: 2700090M07Rik, D230019K20Rik, A730065C02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 213988
VEGA: 15
Homologene: 66194
Lamb3
Name: laminin, beta 3
Synonyms: nicein, 125kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16780
HGNC: HGNC:6490
Homologene: 191
Htr3a
Name: 5-hydroxytryptamine (serotonin) receptor 3A
Synonyms: 5-HT3 receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 15561
VEGA: 9
HGNC: HGNC:5297
Homologene: 671
Cdkn2d
Name: cyclin dependent kinase inhibitor 2D
Synonyms: p19, INK4d, INK4d, p19INK4d
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 12581
VEGA: 9
HGNC: HGNC:1790
Homologene: 36081
Slc6a1
Name: solute carrier family 6 (neurotransmitter transporter, GABA), member 1
Synonyms: Gat1, Gabt1, GAT-1, XT-1, Xtrp1, Gabt
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232333
Homologene: 2290
Dysf
Name: dysferlin
Synonyms: 2310004N10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 26903
HGNC: HGNC:3097
Homologene: 20748
Pzp
Name: PZP, alpha-2-macroglobulin like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 11287
Homologene: 104112
Myo1e
Name: myosin IE
Synonyms: 9130023P14Rik, 2310020N23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 71602
VEGA: 9
HGNC: HGNC:7599
Homologene: 55864
Plxnd1
Name: plexin D1
Synonyms: b2b1863Clo, 6230425C21Rik, b2b553Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 67784
HGNC: HGNC:9107
Homologene: 22866
Pck1
Name: phosphoenolpyruvate carboxykinase 1, cytosolic
Synonyms: PEPCK, Pck-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18534
HGNC: HGNC:8724
Homologene: 1944
Slc4a2
Name: solute carrier family 4 (anion exchanger), member 2
Synonyms: Ae2, B3RP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 20535
Homologene: 128699
Nf1
Name: neurofibromin 1
Synonyms: Nf-1, neurofibromin, Dsk9, Mhdadsk9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 18015
HGNC: HGNC:7765
Homologene: 226
Trip11
Name: thyroid hormone receptor interactor 11
Synonyms: 3110031G15Rik, 6030460N08Rik, 2610511G22Rik, GMAP-210, TRIP230
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 109181
Homologene: 20897
Chd9
Name: chromodomain helicase DNA binding protein 9
Synonyms: A330063D19Rik, 1810014J18Rik, AD013, 9030205D12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 109151
Homologene: 11844
Aar2
Name: AAR2 splicing factor homolog
Synonyms: 0610011L14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 68295
Homologene: 9170
Hectd1
Name: HECT domain E3 ubiquitin protein ligase 1
Synonyms: A630086P08Rik, b2b327Clo, opm
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 207304
VEGA: 12
Homologene: 9115
Skp2
Name: S-phase kinase-associated protein 2 (p45)
Synonyms: FBXL1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 27401
Homologene: 55942
Ccdc191
Name: coiled-coil domain containing 191
Synonyms: 2610015P09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 212153
Homologene: 19484
Dock4
Name: dedicator of cytokinesis 4
Synonyms: EST N28122, 6330411N01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238130
VEGA: 12
Homologene: 56680
Traf2
Name: TNF receptor-associated factor 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22030
Homologene: 22520
Mettl25
Name: methyltransferase like 25
Synonyms: BC067068
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216292
Homologene: 32774
Chmp7
Name: charged multivesicular body protein 7
Synonyms: 6330407G04Rik, CHMP family, member 7, 4930596K11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 105513
VEGA: 14
Homologene: 14613
Marf1
Name: meiosis regulator and mRNA stability 1
Synonyms: 4921513D23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 223989
VEGA: 16
Homologene: 40967
Rasa2
Name: RAS p21 protein activator 2
Synonyms: 5430433H21Rik, GAP1m
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 114713
HGNC: HGNC:9872
Homologene: 4745
Zfp866
Name: zinc finger protein 866
Synonyms: 9830167H18Rik, D330038O06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 330788
Nbn
Name: nibrin
Synonyms: Nbs1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 27354
HGNC: HGNC:7652
Homologene: 1858
Ipo9
Name: importin 9
Synonyms: Imp9, 0710008K06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226432
Homologene: 5874
Adcy1
Name: adenylate cyclase 1
Synonyms: AC1, D11Bwg1392e, I-AC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 432530
HGNC: HGNC:232
Homologene: 41419
Klc1
Name: kinesin light chain 1
Synonyms: Kns2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 16593
HGNC: HGNC:6387
Homologene: 4056
Tmem131
Name: transmembrane protein 131
Synonyms: Rw1, Neg, 2610524E03Rik, D1Bwg0491e, YR-23, CC28
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 56030
Homologene: 32428
Jph3
Name: junctophilin 3
Synonyms: JP-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 57340
Homologene: 10762
Acp5
Name: acid phosphatase 5, tartrate resistant
Synonyms: TRAP, TRACP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 11433
VEGA: 9
HGNC: HGNC:124
Homologene: 137203
Nmbr
Name: neuromedin B receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 18101
HGNC: HGNC:7843
Homologene: 20560
Pah
Name: phenylalanine hydroxylase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 18478
HGNC: HGNC:8582
Homologene: 234
Hspa9
Name: heat shock protein 9
Synonyms: mortalin, Hsc74, Hsp74a, Hsp74, Hspa9a, mot-2, mthsp70, GRP75, PBP74, C3H-specific antigen, CSA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 15526
HGNC: HGNC:5244
Homologene: 39452
Map2
Name: microtubule-associated protein 2
Synonyms: G1-397-34, repro4, Mtap2, MAP-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 17756
HGNC: HGNC:6839
Homologene: 1779
Rbl2
Name: RB transcriptional corepressor like 2
Synonyms: p130, retinoblastoma-like 2, Rb2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 19651
HGNC: HGNC:9894
Homologene: 4098
Pa2g4
Name: proliferation-associated 2G4
Synonyms: Ebp1, Plfap
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 18813
HGNC: HGNC:8550
Homologene: 4513
Med18
Name: mediator complex subunit 18
Synonyms: 2810046C01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 67219
Homologene: 9756
Vps51
Name: VPS51 GARP complex subunit
Synonyms: 3110057M17Rik, 1110014N23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 68505
HGNC: HGNC:1172
Homologene: 34675
Cul2
Name: cullin 2
Synonyms: 1300003D18Rik, 4932411N15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 71745
HGNC: HGNC:2552
Homologene: 2662
Timm21
Name: translocase of inner mitochondrial membrane 21
Synonyms: 2700002I20Rik, 1700034H14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 67105
VEGA: 18
Homologene: 32211
Alg8
Name: asparagine-linked glycosylation 8 (alpha-1,3-glucosyltransferase)
Synonyms: LOC381903
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 381903
Homologene: 6931
Flcn
Name: folliculin
Synonyms: B430214A04Rik, BHD
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216805
Homologene: 14583
Haus3
Name: HAUS augmin-like complex, subunit 3
Synonyms: D5H4S43E, D4S43h, D5H4S43
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231123
Homologene: 75209
Six3
Name: sine oculis-related homeobox 3
Synonyms: E130112M24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 20473
Homologene: 3947
Dclk3
Name: doublecortin-like kinase 3
Synonyms: Click-I, -II related, Dcamkl3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 245038
Homologene: 70580
Dnhd1
Name: dynein heavy chain domain 1
Synonyms: 8030491N06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 77505
Homologene: 131117
Gnai1
Name: guanine nucleotide binding protein (G protein), alpha inhibiting 1
Synonyms: Gialpha1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 14677
HGNC: HGNC:4384
Homologene: 74417
Trp73
Name: transformation related protein 73
Synonyms: deltaNp73, TAp73, p73
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 22062
Homologene: 3960
Sec31b
Name: Sec31 homolog B (S. cerevisiae)
Synonyms: Sec31l2, LOC240667
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 240667
Homologene: 56708
Cfap70
Name: cilia and flagella associated protein 70
Synonyms: Ttc18, 5330402L21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 76670
Homologene: 17048
Slc35f4
Name: solute carrier family 35, member F4
Synonyms: 4930550L21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 75288
Homologene: 45939
Myh8
Name: myosin, heavy polypeptide 8, skeletal muscle, perinatal
Synonyms: Myhsp, 4832426G23Rik, Myhs-p, MyHC-pn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17885
HGNC: HGNC:7578
Homologene: 68256
Cacna1d
Name: calcium channel, voltage-dependent, L type, alpha 1D subunit
Synonyms: Cchl1a, 8430418G19Rik, D-LTCC, Cacnl1a2, Cchl1a2, Cav1.3alpha1, C79217
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 12289
VEGA: 14
HGNC: HGNC:1391
Homologene: 578
Nlrp9c
Name: NLR family, pyrin domain containing 9C
Synonyms: Nalp9c, Nalp-zeta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 330490
Homologene: 116072
Aknad1
Name: AKNA domain containing 1
Synonyms: 4921525H12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 329738
Homologene: 51892
Cfap44
Name: cilia and flagella associated protein 44
Synonyms: Wdr52, 6330444M21Rik, D16Ertd642e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 212517
Homologene: 75085
Trpm5
Name: transient receptor potential cation channel, subfamily M, member 5
Synonyms: 9430099A16Rik, Ltrpc5, Mtr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 56843
Homologene: 22818
Ppfia4
Name: protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4
Synonyms: 1110008G13Rik, Liprin-alpha4, LOC100042382, Gm3812
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 68507
HGNC: HGNC:9248
Homologene: 66200
Hal
Name: histidine ammonia lyase
Synonyms: histidase, Hsd
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 15109
HGNC: HGNC:4806
Homologene: 68229
Raet1c
Name: retinoic acid early transcript gamma
Synonyms: RAE-1gamma
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Il4ra
Name: interleukin 4 receptor, alpha
Synonyms: CD124, Il4r, IL-4 receptor alpha chain
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16190
HGNC: HGNC:6015
Homologene: 7784
Zfp329
Name: zinc finger protein 329
Synonyms: 4632409L22Rik, 2810439M05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 67230
Homologene: 23459
Col4a1
Name: collagen, type IV, alpha 1
Synonyms: Svc, Del(8)Bru44H, Del(8)44H, Bru, Raw, Col4a-1, alpha1(IV) collagen
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 12826
HGNC: HGNC:2202
Homologene: 20437
Myo3b
Name: myosin IIIB
Synonyms: A430065P19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 329421
Homologene: 51393
Otogl
Name: otogelin-like
Synonyms: Gm6924
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 628870
Homologene: 46008
Cts6
Name: cathepsin 6
Synonyms: 1600022N02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 58518
Homologene: 75165
Nt5e
Name: 5' nucleotidase, ecto
Synonyms: 2210401F01Rik, ecto-5'-nucleotidase, CD73, Nt5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 23959
HGNC: HGNC:8021
Homologene: 1895
Ift140
Name: intraflagellar transport 140
Synonyms: Wdtc2, Tce5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 106633
Homologene: 40979
Kif14
Name: kinesin family member 14
Synonyms: D1Ertd367e, N-3 kinesin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 381293
Homologene: 8916
Atrnl1
Name: attractin like 1
Synonyms: Alp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 226255
VEGA: 19
Homologene: 45809
Espnl
Name: espin-like
Synonyms: LOC227357
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227357
Homologene: 77795
Rims4
Name: regulating synaptic membrane exocytosis 4
Synonyms: Rim4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241770
Homologene: 18123
Kcnb1
Name: potassium voltage gated channel, Shab-related subfamily, member 1
Synonyms: Shab, Kcr1-1, Kv2.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 16500
HGNC: HGNC:6231
Homologene: 37988
Olfr593
Name: olfactory receptor 593
Synonyms: GA_x6K02T2PBJ9-5927412-5928362, MOR24-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258378
Homologene: 27147
H1f6
Name: H1.6 linker histone, cluster member
Synonyms: Hist1h1t, H1ft, H1t
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 107970
HGNC: HGNC:4720
Homologene: 3889
Krt17
Name: keratin 17
Synonyms: Krt1-17, K17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 16667
HGNC: HGNC:6427
Homologene: 363
Rab39
Name: RAB39, member RAS oncogene family
Synonyms: Rab39a, C230094F14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 270160
Homologene: 56773
Fam163b
Name: family with sequence similarity 163, member B
Synonyms: C630035N08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 109349
Homologene: 106097
Olfr1126
Name: olfactory receptor 1126
Synonyms: GA_x6K02T2Q125-48959068-48960012, MOR264-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258834
Homologene: 133659
Adra1d
Name: adrenergic receptor, alpha 1d
Synonyms: alpha1D-AR, Adra-1, Adra1a, Gpcr8, Adra1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 11550
HGNC: HGNC:280
Homologene: 551
Slc52a3
Name: solute carrier protein family 52, member 3
Synonyms: 2310046K01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 69698
Homologene: 12324
Rars2
Name: arginyl-tRNA synthetase 2, mitochondrial
Synonyms: 1500002I10Rik, Rarsl, PRO1992
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 109093
Homologene: 5707
Myorg
Name: myogenesis regulating glycosidase (putative)
Synonyms: NET37, AI464131
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 329828
Homologene: 19853
Mpl
Name: myeloproliferative leukemia virus oncogene
Synonyms: c-mpl, c-mpl-I, hlb219, c-mpl-II, CD110, thrombopoietin receptor, TPO-R
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 17480
HGNC: HGNC:7217
Homologene: 7845
Trim54
Name: tripartite motif-containing 54
Synonyms: 4930486E09Rik, MuRF3, 4930566I02Rik, Rnf30
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 58522
Homologene: 10983
Cnga1
Name: cyclic nucleotide gated channel alpha 1
Synonyms: Cncg
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 12788
HGNC: HGNC:2148
Homologene: 55432
Ccdc158
Name: coiled-coil domain containing 158
Synonyms: 4932413O14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 320696
Homologene: 18560
Cdx2
Name: caudal type homeobox 2
Synonyms: Cdx-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 12591
HGNC: HGNC:1806
Homologene: 968
Ndufa4
Name: Ndufa4, mitochondrial complex associated
Synonyms: MLRQ
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 17992
HGNC: HGNC:7687
Homologene: 37629
Zfp777
Name: zinc finger protein 777
Synonyms: 2500002G23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 72306
Homologene: 56721
Lrmp
Name: lymphoid-restricted membrane protein
Synonyms: Jaw1, D6Int3, D6Int4, D6Int7, D6Int5, D6Int8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 16970
HGNC: HGNC:6690
Homologene: 4483
Hpn
Name: hepsin
Synonyms: Hlb320
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 15451
HGNC: HGNC:5155
Homologene: 20498
Scgb1b27
Name: secretoglobin, family 1B, member 27
Synonyms: Sal-1, Abp, Abpa, Abpa27, Tcp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 11354
Homologene: 114479
Olfr694
Name: olfactory receptor 694
Synonyms: GA_x6K02T2PBJ9-9067220-9066273, MOR283-9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258444
Homologene: 79345
Fam89a
Name: family with sequence similarity 89, member A
Synonyms: 2310031A18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 69627
Homologene: 18887
Map3k21
Name: mitogen-activated protein kinase kinase kinase 21
Synonyms: BC021891
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234878
Homologene: 32778
Mcam
Name: melanoma cell adhesion molecule
Synonyms: Muc18, 1-gicerin, s-endo, s-gicerin, CD146
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 84004
HGNC: HGNC:6934
Homologene: 4742
Susd5
Name: sushi domain containing 5
Synonyms: LOC382111
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 382111
VEGA: 9
Homologene: 19526
Tmem63c
Name: transmembrane protein 63c
Synonyms: 9330187M14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217733
Homologene: 33129
Micu2
Name: mitochondrial calcium uptake 2
Synonyms: 4833427E09Rik, 1110008L20Rik, Efha1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 68514
VEGA: 14
Homologene: 12516
Nubp2
Name: nucleotide binding protein 2
Synonyms: D17Wsu11e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 26426
VEGA: 17
HGNC: HGNC:8042
Homologene: 8057
Pcdhb12
Name: protocadherin beta 12
Synonyms: Pcdhb5F, PcdhbL, Pcdh3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93883
Homologene: 87126
Pga5
Name: pepsinogen 5, group I
Synonyms: Pepf, pepsinogen A5, 1110035E17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 58803
VEGA: 19
Homologene: 105932
Zfp729b
Name: zinc finger protein 729b
Synonyms: AA987161
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 100416706
Homologene: 133713
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 36,828,050 bp
  • A to G, chromosome 1 at 66,416,106 bp
  • T to C, chromosome 1 at 91,322,287 bp
  • T to C, chromosome 1 at 134,329,189 bp
  • A to G, chromosome 1 at 135,404,336 bp
  • A to G, chromosome 1 at 136,527,393 bp
  • A to T, chromosome 1 at 193,321,053 bp
  • G to C, chromosome 2 at 25,537,126 bp
  • T to C, chromosome 2 at 27,112,634 bp
  • T to A, chromosome 2 at 70,105,425 bp
  • T to C, chromosome 2 at 87,458,037 bp
  • C to A, chromosome 2 at 131,546,214 bp
  • T to C, chromosome 2 at 152,008,156 bp
  • T to G, chromosome 2 at 156,550,973 bp
  • C to T, chromosome 2 at 163,864,025 bp
  • A to G, chromosome 2 at 167,104,969 bp
  • T to G, chromosome 2 at 173,157,068 bp
  • A to G, chromosome 3 at 108,781,239 bp
  • T to C, chromosome 4 at 15,986,672 bp
  • T to C, chromosome 4 at 34,645,838 bp
  • A to C, chromosome 4 at 34,656,030 bp
  • A to T, chromosome 4 at 41,498,912 bp
  • A to G, chromosome 4 at 118,456,863 bp
  • T to C, chromosome 4 at 132,460,026 bp
  • AGCTGCTGCTGCTGCTGCTG to AGCTGCTGCTGCTGCTG, chromosome 4 at 154,062,524 bp
  • A to G, chromosome 5 at 18,273,550 bp
  • A to T, chromosome 5 at 24,436,274 bp
  • A to G, chromosome 5 at 31,134,119 bp
  • G to A, chromosome 5 at 34,166,256 bp
  • A to G, chromosome 5 at 72,605,031 bp
  • A to C, chromosome 5 at 92,662,118 bp
  • G to T, chromosome 5 at 147,303,287 bp
  • C to T, chromosome 6 at 11,906,024 bp
  • T to C, chromosome 6 at 48,024,969 bp
  • C to T, chromosome 6 at 84,064,479 bp
  • G to A, chromosome 6 at 114,302,800 bp
  • G to T, chromosome 6 at 115,968,793 bp
  • C to T, chromosome 6 at 128,489,156 bp
  • G to A, chromosome 6 at 145,171,978 bp
  • G to T, chromosome 7 at 12,810,829 bp
  • A to G, chromosome 7 at 26,378,012 bp
  • G to T, chromosome 7 at 31,099,390 bp
  • G to A, chromosome 7 at 34,021,952 bp
  • A to T, chromosome 7 at 97,383,684 bp
  • G to A, chromosome 7 at 103,212,726 bp
  • A to G, chromosome 7 at 105,721,531 bp
  • A to G, chromosome 7 at 106,689,255 bp
  • T to C, chromosome 7 at 125,575,199 bp
  • G to T, chromosome 7 at 143,082,958 bp
  • C to T, chromosome 8 at 11,218,780 bp
  • T to C, chromosome 8 at 69,766,715 bp
  • T to C, chromosome 8 at 90,932,828 bp
  • A to T, chromosome 8 at 91,106,507 bp
  • A to G, chromosome 8 at 121,753,720 bp
  • A to G, chromosome 8 at 124,741,232 bp
  • A to G, chromosome 8 at 125,944,970 bp
  • C to A, chromosome 9 at 21,290,992 bp
  • A to T, chromosome 9 at 22,129,922 bp
  • T to G, chromosome 9 at 44,140,205 bp
  • T to C, chromosome 9 at 48,906,386 bp
  • G to A, chromosome 9 at 53,706,030 bp
  • A to T, chromosome 9 at 70,342,126 bp
  • A to G, chromosome 9 at 88,367,332 bp
  • A to T, chromosome 9 at 96,568,407 bp
  • A to T, chromosome 9 at 111,482,628 bp
  • A to G, chromosome 9 at 114,096,909 bp
  • C to T, chromosome 10 at 14,770,395 bp
  • C to A, chromosome 10 at 22,180,862 bp
  • C to T, chromosome 10 at 87,567,281 bp
  • T to C, chromosome 10 at 93,503,482 bp
  • C to T, chromosome 10 at 105,826,525 bp
  • T to A, chromosome 10 at 107,806,696 bp
  • T to C, chromosome 10 at 128,563,642 bp
  • C to G, chromosome 11 at 7,139,162 bp
  • T to C, chromosome 11 at 59,801,076 bp
  • A to G, chromosome 11 at 67,301,692 bp
  • A to T, chromosome 11 at 79,418,574 bp
  • G to A, chromosome 11 at 100,260,878 bp
  • G to T, chromosome 12 at 40,737,540 bp
  • T to A, chromosome 12 at 51,769,318 bp
  • T to C, chromosome 12 at 87,075,639 bp
  • C to T, chromosome 12 at 101,884,728 bp
  • A to G, chromosome 12 at 111,785,324 bp
  • G to T, chromosome 13 at 23,696,324 bp
  • T to A, chromosome 13 at 61,201,819 bp
  • A to G, chromosome 13 at 67,591,903 bp
  • A to C, chromosome 14 at 20,448,605 bp
  • A to G, chromosome 14 at 30,123,496 bp
  • A to T, chromosome 14 at 49,304,256 bp
  • G to A, chromosome 14 at 57,917,378 bp
  • A to G, chromosome 14 at 69,720,997 bp
  • A to C, chromosome 15 at 9,127,884 bp
  • A to G, chromosome 15 at 80,887,864 bp
  • T to C, chromosome 16 at 14,151,283 bp
  • A to T, chromosome 16 at 43,947,496 bp
  • T to A, chromosome 16 at 44,422,318 bp
  • T to C, chromosome 17 at 24,884,471 bp
  • C to A, chromosome 17 at 25,045,523 bp
  • G to A, chromosome 17 at 85,621,390 bp
  • A to G, chromosome 18 at 3,414,115 bp
  • A to T, chromosome 18 at 34,946,646 bp
  • A to G, chromosome 18 at 37,436,727 bp
  • T to C, chromosome 18 at 84,947,666 bp
  • G to T, chromosome 19 at 6,071,437 bp
  • A to G, chromosome 19 at 10,669,453 bp
  • G to A, chromosome 19 at 44,525,469 bp
  • T to A, chromosome 19 at 57,682,359 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0238 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
038476-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.