Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR0238Btlr/Mmmh
Stock Number:
038476-MU
Citation ID:
RRID:MMRRC_038476-MU
Other Names:
R0238 (G1), C57BL/6J-MtgxR0238Btlr
Major Collection:

Strain Information

Tnrc6b
Name: trinucleotide repeat containing 6b
Synonyms: A730065C02Rik, D230019K20Rik, 2700090M07Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 213988
VEGA: 15
Homologene: 66194
Lamb3
Name: laminin, beta 3
Synonyms: nicein, 125kDa
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16780
HGNC: HGNC:6490
Homologene: 191
Htr3a
Name: 5-hydroxytryptamine (serotonin) receptor 3A
Synonyms: 5-HT3 receptor
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 15561
VEGA: 9
HGNC: HGNC:5297
Homologene: 671
Cdkn2d
Name: cyclin dependent kinase inhibitor 2D
Synonyms: p19, INK4d, p19INK4d, INK4d
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12581
VEGA: 9
HGNC: HGNC:1790
Homologene: 36081
Slc6a1
Name: solute carrier family 6 (neurotransmitter transporter, GABA), member 1
Synonyms: XT-1, Gabt, Xtrp1, Gat1, Gabt1, GAT-1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232333
Homologene: 2290
Pzp2
Name: PZP alpha-2-macroglobulin like 2
Synonyms: Pzp
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11287
Homologene: 104112
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 36,828,050 bp
  • A to G, chromosome 1 at 66,416,106 bp
  • T to C, chromosome 1 at 91,322,287 bp
  • T to C, chromosome 1 at 134,329,189 bp
  • A to G, chromosome 1 at 135,404,336 bp
  • A to G, chromosome 1 at 136,527,393 bp
  • A to T, chromosome 1 at 193,321,053 bp
  • G to C, chromosome 2 at 25,537,126 bp
  • T to C, chromosome 2 at 27,112,634 bp
  • T to A, chromosome 2 at 70,105,425 bp
  • T to C, chromosome 2 at 87,458,037 bp
  • C to A, chromosome 2 at 131,546,214 bp
  • T to C, chromosome 2 at 152,008,156 bp
  • T to G, chromosome 2 at 156,550,973 bp
  • C to T, chromosome 2 at 163,864,025 bp
  • A to G, chromosome 2 at 167,104,969 bp
  • T to G, chromosome 2 at 173,157,068 bp
  • A to G, chromosome 3 at 108,781,239 bp
  • T to C, chromosome 4 at 15,986,672 bp
  • T to C, chromosome 4 at 34,645,838 bp
  • A to C, chromosome 4 at 34,656,030 bp
  • A to T, chromosome 4 at 41,498,912 bp
  • A to G, chromosome 4 at 118,456,863 bp
  • T to C, chromosome 4 at 132,460,026 bp
  • AGCTGCTGCTGCTGCTGCTG to AGCTGCTGCTGCTGCTG, chromosome 4 at 154,062,524 bp
  • A to G, chromosome 5 at 18,273,550 bp
  • A to T, chromosome 5 at 24,436,274 bp
  • A to G, chromosome 5 at 31,134,119 bp
  • G to A, chromosome 5 at 34,166,256 bp
  • A to G, chromosome 5 at 72,605,031 bp
  • A to C, chromosome 5 at 92,662,118 bp
  • G to T, chromosome 5 at 147,303,287 bp
  • C to T, chromosome 6 at 11,906,024 bp
  • T to C, chromosome 6 at 48,024,969 bp
  • C to T, chromosome 6 at 84,064,479 bp
  • G to A, chromosome 6 at 114,302,800 bp
  • G to T, chromosome 6 at 115,968,793 bp
  • C to T, chromosome 6 at 128,489,156 bp
  • G to A, chromosome 6 at 145,171,978 bp
  • G to T, chromosome 7 at 12,810,829 bp
  • A to G, chromosome 7 at 26,378,012 bp
  • G to T, chromosome 7 at 31,099,390 bp
  • G to A, chromosome 7 at 34,021,952 bp
  • A to T, chromosome 7 at 97,383,684 bp
  • G to A, chromosome 7 at 103,212,726 bp
  • A to G, chromosome 7 at 105,721,531 bp
  • A to G, chromosome 7 at 106,689,255 bp
  • T to C, chromosome 7 at 125,575,199 bp
  • G to T, chromosome 7 at 143,082,958 bp
  • C to T, chromosome 8 at 11,218,780 bp
  • T to C, chromosome 8 at 69,766,715 bp
  • T to C, chromosome 8 at 90,932,828 bp
  • A to T, chromosome 8 at 91,106,507 bp
  • A to G, chromosome 8 at 121,753,720 bp
  • A to G, chromosome 8 at 124,741,232 bp
  • A to G, chromosome 8 at 125,944,970 bp
  • C to A, chromosome 9 at 21,290,992 bp
  • A to T, chromosome 9 at 22,129,922 bp
  • T to G, chromosome 9 at 44,140,205 bp
  • T to C, chromosome 9 at 48,906,386 bp
  • G to A, chromosome 9 at 53,706,030 bp
  • A to T, chromosome 9 at 70,342,126 bp
  • A to G, chromosome 9 at 88,367,332 bp
  • A to T, chromosome 9 at 96,568,407 bp
  • A to T, chromosome 9 at 111,482,628 bp
  • A to G, chromosome 9 at 114,096,909 bp
  • C to T, chromosome 10 at 14,770,395 bp
  • C to A, chromosome 10 at 22,180,862 bp
  • C to T, chromosome 10 at 87,567,281 bp
  • T to C, chromosome 10 at 93,503,482 bp
  • C to T, chromosome 10 at 105,826,525 bp
  • T to A, chromosome 10 at 107,806,696 bp
  • T to C, chromosome 10 at 128,563,642 bp
  • C to G, chromosome 11 at 7,139,162 bp
  • T to C, chromosome 11 at 59,801,076 bp
  • A to G, chromosome 11 at 67,301,692 bp
  • A to T, chromosome 11 at 79,418,574 bp
  • G to A, chromosome 11 at 100,260,878 bp
  • G to T, chromosome 12 at 40,737,540 bp
  • T to A, chromosome 12 at 51,769,318 bp
  • T to C, chromosome 12 at 87,075,639 bp
  • C to T, chromosome 12 at 101,884,728 bp
  • A to G, chromosome 12 at 111,785,324 bp
  • G to T, chromosome 13 at 23,696,324 bp
  • T to A, chromosome 13 at 61,201,819 bp
  • A to G, chromosome 13 at 67,591,903 bp
  • A to C, chromosome 14 at 20,448,605 bp
  • A to G, chromosome 14 at 30,123,496 bp
  • A to T, chromosome 14 at 49,304,256 bp
  • G to A, chromosome 14 at 57,917,378 bp
  • A to G, chromosome 14 at 69,720,997 bp
  • A to C, chromosome 15 at 9,127,884 bp
  • A to G, chromosome 15 at 80,887,864 bp
  • T to C, chromosome 16 at 14,151,283 bp
  • A to T, chromosome 16 at 43,947,496 bp
  • T to A, chromosome 16 at 44,422,318 bp
  • T to C, chromosome 17 at 24,884,471 bp
  • C to A, chromosome 17 at 25,045,523 bp
  • G to A, chromosome 17 at 85,621,390 bp
  • A to G, chromosome 18 at 3,414,115 bp
  • A to T, chromosome 18 at 34,946,646 bp
  • A to G, chromosome 18 at 37,436,727 bp
  • T to C, chromosome 18 at 84,947,666 bp
  • G to T, chromosome 19 at 6,071,437 bp
  • A to G, chromosome 19 at 10,669,453 bp
  • G to A, chromosome 19 at 44,525,469 bp
  • T to A, chromosome 19 at 57,682,359 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0238 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038476-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.