Strain Name:
C57BL/6J-MtgxR0738Btlr/Mmmh
Stock Number:
038919-MU
Citation ID:
RRID:MMRRC_038919-MU
Other Names:
R0738 (G1), C57BL/6J-MtgxR0738Btlr
Major Collection:

Gene Information

Mad1l1
Name: MAD1 mitotic arrest deficient 1-like 1
Synonyms: Mad1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 17120
HGNC: HGNC:6762
Homologene: 74500
Cd9
Name: CD9 antigen
Synonyms: Tspan29
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 12527
HGNC: HGNC:1709
Homologene: 20420
Herc4
Name: hect domain and RLD 4
Synonyms: 4921531D01Rik, 1700056O17Rik, 9530080M15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 67345
VEGA: 10
Homologene: 56715
Rc3h2
Name: ring finger and CCCH-type zinc finger domains 2
Synonyms: Rnf164, D930043C02Rik, 2900024N03Rik, 9430019J22Rik, Mnab
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 319817
Homologene: 28276
Med13l
Name: mediator complex subunit 13-like
Synonyms: 2210413I17Rik, 6330591G05Rik, Trap240L, 9030618F05Rik, Thrap2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 76199
Homologene: 25256
Dctn1
Name: dynactin 1
Synonyms: Glued, p150, p150glued
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 13191
HGNC: HGNC:2711
Homologene: 3011
Lrp6
Name: low density lipoprotein receptor-related protein 6
Synonyms: skam26Jus, Cd, ska26, skax26
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 16974
HGNC: HGNC:6698
Homologene: 1747
Wdr5
Name: WD repeat domain 5
Synonyms: Big-3, 2410008O07Rik, Bmp2-induced gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 140858
Homologene: 59931
Rbm26
Name: RNA binding motif protein 26
Synonyms: Pro1777, C230097K14Rik, 1700009P03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 74213
Homologene: 41468
Fkbp8
Name: FK506 binding protein 8
Synonyms: Fkbp38, 38kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 14232
HGNC: HGNC:3724
Homologene: 7720
Map2
Name: microtubule-associated protein 2
Synonyms: MAP-2, G1-397-34, Mtap2, repro4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 17756
HGNC: HGNC:6839
Homologene: 1779
Itsn2
Name: intersectin 2
Synonyms: Sh3p18, Ese2, Eh domain, SH3 domain regulator of endocytosis 2, Sh3d1B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 20403
VEGA: 12
HGNC: HGNC:6184
Homologene: 22627
Zfyve26
Name: zinc finger, FYVE domain containing 26
Synonyms: 9330197E15Rik, LOC380767, A630028O16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 211978
VEGA: 12
Homologene: 9102
Rasgef1b
Name: RasGEF domain family, member 1B
Synonyms: Gpig4, 4732452O09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 320292
Homologene: 14860
Ank1
Name: ankyrin 1, erythroid
Synonyms: Ank-1, pale
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 11733
HGNC: HGNC:492
Homologene: 55427
Tarbp1
Name: TAR RNA binding protein 1
Synonyms: Gm17296
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 212728
Homologene: 38082
Cdc42bpa
Name: CDC42 binding protein kinase alpha
Synonyms: DMPK-like, A930014J19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226751
HGNC: HGNC:1737
Homologene: 55765
Pcdhb4
Name: protocadherin beta 4
Synonyms: Pcdhb5A, PcdhbD
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93875
Homologene: 62176
Mttp
Name: microsomal triglyceride transfer protein
Synonyms: MTP, 1810043K16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 17777
HGNC: HGNC:7467
Homologene: 212
Epha3
Name: Eph receptor A3
Synonyms: Tyro4, Mek4, Hek4, Hek, Cek4, End3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 13837
VEGA: 16
HGNC: HGNC:3387
Homologene: 21083
Kcp
Name: kielin/chordin-like protein
Synonyms: LOC333088, KCP, Crim2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 333088
Homologene: 87817
Defa22
Name: defensin, alpha, 22
Synonyms: Defcr22
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 382059
Homologene: 113382
Mgam
Name: maltase-glucoamylase
Synonyms: 6030407P20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232714
HGNC: HGNC:7043
Homologene: 130099
Ptpro
Name: protein tyrosine phosphatase, receptor type, O
Synonyms: D28, PTPROt, PTP-phi, PTP-BK, PTP-U2, GLEPP1, PTP-oc, Ptpn15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 19277
HGNC: HGNC:9678
Homologene: 21564
Nfatc1
Name: nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 1
Synonyms: NFAT2, NFATc, NF-ATc, 2210017P03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 18018
VEGA: 18
HGNC: HGNC:7775
Homologene: 32336
Dscam
Name: DS cell adhesion molecule
Synonyms: 4932410A21Rik, Down syndrome cell adhesion molecule
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 13508
HGNC: HGNC:3039
Homologene: 74393
Ankhd1
Name: ankyrin repeat and KH domain containing 1
Synonyms: 1110004O12Rik, 9130019P20Rik, 4933432B13Rik, A530027J04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 108857
Homologene: 87006
Vmn2r27
Name: vomeronasal 2, receptor27
Synonyms: EG232367
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232367
Nsd3
Name: nuclear receptor binding SET domain protein 3
Synonyms: WHISTLE, Whsc1l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234135
Homologene: 56960
Plch1
Name: phospholipase C, eta 1
Synonyms: PLCeta1, Plcl3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 269437
Homologene: 88833
Ninj2
Name: ninjurin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 29862
HGNC: HGNC:7825
Homologene: 9555
Lrfn5
Name: leucine rich repeat and fibronectin type III domain containing 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238205
Homologene: 17582
Popdc3
Name: popeye domain containing 3
Synonyms: Pop3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 78977
Homologene: 32540
Tll1
Name: tolloid-like
Synonyms: Tll-1, b2b2476Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 21892
Homologene: 49202
Olfr1454
Name: olfactory receptor 1454
Synonyms: GA_x6K02T2RE5P-3390804-3391727, MOR202-14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 258687
Homologene: 120159
Olfr895
Name: olfactory receptor 895
Synonyms: GA_x6K02T2PVTD-31962461-31963411, MOR170-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258875
Homologene: 74253
Thnsl1
Name: threonine synthase-like 1 (bacterial)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 208967
Homologene: 32609
Spopl
Name: speckle-type BTB/POZ protein-like
Synonyms: E430033K04Rik, 4921517N04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 76857
Homologene: 78016
Mllt11
Name: myeloid/lymphoid or mixed-lineage leukemia; translocated to, 11
Synonyms: Af1q
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 56772
Homologene: 4964
Fam241a
Name: family with sequence similarity 241, member A
Synonyms: 5730508B09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 70617
Homologene: 12361
Samd1
Name: sterile alpha motif domain containing 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 666704
Homologene: 124206
Ch25h
Name: cholesterol 25-hydroxylase
Synonyms: m25OH
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 12642
VEGA: 19
HGNC: HGNC:1907
Homologene: 2942
Mid2
Name: midline 2
Synonyms: FXY2, Trim1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 23947
HGNC: HGNC:7096
Homologene: 8028
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 66,425,189 bp
  • T to A, chromosome 1 at 179,999,462 bp
  • T to A, chromosome 2 at 21,213,362 bp
  • T to C, chromosome 2 at 23,537,521 bp
  • T to C, chromosome 2 at 27,519,412 bp
  • T to A, chromosome 2 at 37,405,374 bp
  • T to C, chromosome 3 at 63,702,553 bp
  • G to A, chromosome 3 at 95,220,286 bp
  • C to A, chromosome 3 at 127,870,793 bp
  • A to G, chromosome 3 at 138,103,313 bp
  • A to T, chromosome 5 at 99,240,953 bp
  • T to A, chromosome 5 at 118,751,633 bp
  • A to G, chromosome 5 at 140,300,560 bp
  • A to T, chromosome 6 at 29,490,439 bp
  • A to G, chromosome 6 at 40,754,935 bp
  • T to C, chromosome 6 at 83,190,107 bp
  • A to G, chromosome 6 at 120,198,137 bp
  • A to T, chromosome 6 at 124,223,702 bp
  • G to T, chromosome 6 at 125,462,140 bp
  • G to T, chromosome 6 at 134,542,045 bp
  • T to A, chromosome 6 at 137,443,594 bp
  • C to T, chromosome 8 at 21,162,375 bp
  • A to T, chromosome 8 at 23,114,114 bp
  • T to A, chromosome 8 at 25,678,709 bp
  • T to C, chromosome 8 at 64,101,950 bp
  • T to A, chromosome 8 at 70,529,670 bp
  • CGAGGAGGAGGAGGAGGAGGA to CGAGGAGGAGGAGGAGGA, chromosome 8 at 83,998,996 bp
  • A to G, chromosome 8 at 126,438,801 bp
  • T to C, chromosome 9 at 38,269,125 bp
  • T to C, chromosome 10 at 45,315,258 bp
  • C to T, chromosome 10 at 63,289,149 bp
  • T to C, chromosome 12 at 4,635,681 bp
  • G to T, chromosome 12 at 61,840,592 bp
  • A to T, chromosome 12 at 79,295,534 bp
  • A to T, chromosome 14 at 105,176,782 bp
  • T to C, chromosome 16 at 63,595,612 bp
  • T to C, chromosome 16 at 96,819,781 bp
  • A to G, chromosome 18 at 36,645,249 bp
  • A to G, chromosome 18 at 37,308,711 bp
  • A to G, chromosome 18 at 80,697,910 bp
  • A to T, chromosome 19 at 13,063,738 bp
  • T to C, chromosome 19 at 34,474,387 bp
  • A to G, chromosome X at 140,763,676 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0738 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
038919-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.