Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1218Btlr/Mmmh
Stock Number:
039287-MU
Citation ID:
RRID:MMRRC_039287-MU
Other Names:
R1218 (G1), C57BL/6J-MtgxR1218Btlr
Major Collection:

Strain Information

Bmp6
Name: bone morphogenetic protein 6
Synonyms: Vgr1, D13Wsu115e
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12161
VEGA: 13
HGNC: HGNC:1073
Homologene: 1300
Cbfa2t2
Name: CBFA2/RUNX1 translocation partner 2
Synonyms: MTGR1, C330013D05Rik, Cbfa2t2h
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12396
HGNC: HGNC:1536
Homologene: 3733
Odf2l
Name: outer dense fiber of sperm tails 2-like
Synonyms: 4733401D09Rik, 9630045K08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 52184
Homologene: 12011
H2bc3
Name: H2B clustered histone 3
Synonyms: H2b-143, Hist1h2bb
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 319178
HGNC: HGNC:4751
Homologene: 137348
Chd1
Name: chromodomain helicase DNA binding protein 1
Synonyms: 4930525N21Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12648
HGNC: HGNC:1915
Homologene: 68174
Xrcc6
Name: X-ray repair complementing defective repair in Chinese hamster cells 6
Synonyms: Ku p70, Ku70, G22p1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14375
HGNC: HGNC:4055
Homologene: 37483
Trrap
Name: transformation/transcription domain-associated protein
Synonyms: transactivation/transformation-domain associated protein
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100683
Homologene: 39246
Dmxl1
Name: Dmx-like 1
Synonyms: C630007L23Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240283
HGNC: HGNC:2937
Homologene: 21136
Mtrex
Name: Mtr4 exosome RNA helicase
Synonyms: 2610528A15Rik, Skiv2l2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72198
VEGA: 13
Homologene: 6257
Dhx40
Name: DEAH-box helicase 40
Synonyms: ARG147, DDX40, 2410016C14Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67487
Homologene: 57000
Gdf10
Name: growth differentiation factor 10
Synonyms: Bmp3b
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14560
VEGA: 14
HGNC: HGNC:4215
Homologene: 3640
Zfyve1
Name: zinc finger, FYVE domain containing 1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217695
VEGA: 12
Homologene: 10945
Wdr76
Name: WD repeat domain 76
Synonyms: 5830411K18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241627
Homologene: 38573
Kifc1
Name: kinesin family member C1
Synonyms: Tctex-7, Tctex-7A, Tctex7, Tctex7a, kinesin family c-terminal 5A, HSET, KNSL2, Kifc5a, Gm4137, Knsl2a
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100502766
HGNC: HGNC:6389
Homologene: 83229
Dlst
Name: dihydrolipoamide S-succinyltransferase
Synonyms: 4930529O08Rik, 1600017E01Rik, 4632413C10Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 78920
VEGA: 12
HGNC: HGNC:2911
Homologene: 1456
Napb
Name: N-ethylmaleimide sensitive fusion protein attachment protein beta
Synonyms: SNARE, b-SNAP, I47, E161, Brp14
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17957
Homologene: 5332
Car9
Name: carbonic anhydrase 9
Synonyms: CAIX, MN/CA9
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230099
HGNC: HGNC:1383
Homologene: 20325
Flrt2
Name: fibronectin leucine rich transmembrane protein 2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 399558
HGNC: HGNC:3761
Homologene: 8291
Exosc10
Name: exosome component 10
Synonyms: PM/Scl-100, PM-Scl, RRP6, p4, p3, p2, Pmscl2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 50912
HGNC: HGNC:9138
Homologene: 31105
Inava
Name: innate immunity activator
Synonyms: 5730559C18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67313
Homologene: 10103
Olfml2b
Name: olfactomedin-like 2B
Synonyms: 1110018N05Rik, 4832415H08Rik, photomedin-2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 320078
Homologene: 18546
Ryr1
Name: ryanodine receptor 1, skeletal muscle
Synonyms: calcium release channel isoform 1, Ryr, skrr
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20190
Homologene: 68069
Fbn1
Name: fibrillin 1
Synonyms: Fib-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14118
HGNC: HGNC:3603
Homologene: 30958
Pcdhb10
Name: protocadherin beta 10
Synonyms: Pcdhb5D, PcdhbJ
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93881
HGNC: HGNC:8690
Homologene: 88834
Polq
Name: polymerase (DNA directed), theta
Synonyms: A430110D14Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 77782
HGNC: HGNC:9186
Homologene: 32727
Zfp458
Name: zinc finger protein 458
Synonyms: Rslcan-7
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238690
VEGA: 13
Homologene: 128170
Sstr1
Name: somatostatin receptor 1
Synonyms: sst1, Smstr-1, Smstr1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20605
Homologene: 820
Rims1
Name: regulating synaptic membrane exocytosis 1
Synonyms: RIM1, RIM1a, C030033M19Rik, RIM1alpha
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 116837
Homologene: 128399
Faap100
Name: Fanconi anemia core complex associated protein 100
Synonyms: 2310003H01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71885
Homologene: 69394
Myh2
Name: myosin, heavy polypeptide 2, skeletal muscle, adult
Synonyms: MyHC-IIa, MHC2A, Myhs-f1, Myhs-f, Myhsf1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17882
HGNC: HGNC:7572
Homologene: 23019
Mprip
Name: myosin phosphatase Rho interacting protein
Synonyms: RIP3, p116Rip, p116 Rho interacting protein, Rhoip3, Gm34094
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 26936
Homologene: 9034
Ahnak
Name: AHNAK nucleoprotein
Synonyms: DY6, 2310047C17Rik, 1110004P15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66395
VEGA: 19
HGNC: HGNC:347
Homologene: 67425
4930407I10Rik
Name: RIKEN cDNA 4930407I10 gene
Synonyms: LOC328573
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 328573
VEGA: 15
Homologene: 130065
4932425I24Rik
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Tmem241
Name: transmembrane protein 241
Synonyms: 6030446N20Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 338363
Homologene: 87267
Ceacam20
Name: CEA cell adhesion molecule 20
Synonyms: 9130012D09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71601
Homologene: 19010
Mcpt9
Name: mast cell protease 9
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 17232
VEGA: 14
Homologene: 115745
Snx33
Name: sorting nexin 33
Synonyms: E130307J07Rik, Sh3px3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235406
VEGA: 9
Homologene: 45165
Ano5
Name: anoctamin 5
Synonyms: Gdd1, Tmem16e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233246
Homologene: 100071
Stx6
Name: syntaxin 6
Synonyms: 2310039E05Rik, 2410005I16Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 58244
Homologene: 115622
Oscp1
Name: organic solute carrier partner 1
Synonyms: 6030436A01Rik, 1810007P19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230751
Homologene: 71010
Mepe
Name: matrix extracellular phosphoglycoprotein with ASARM motif (bone)
Synonyms: OF45
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 94111
Homologene: 10623
5330417H12Rik
Name: RIKEN cDNA 5330417H12 gene
Type: Gene
Species: Mouse
Chromosome: 7
Kcnn1
Name: potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1
Synonyms: SK1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 84036
HGNC: HGNC:6290
Homologene: 37595
Tnfaip8l3
Name: tumor necrosis factor, alpha-induced protein 8-like 3
Synonyms: LOC244882, 9930029P06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244882
VEGA: 9
Homologene: 19480
9230109A22Rik
Name: RIKEN cDNA 9230109A22 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Ly6g
Name: lymphocyte antigen 6 family member G
Synonyms: Gr1, Ly-6G, Gr-1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 546644
Homologene: 113718
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 22,483,175 bp
  • A to T, chromosome 1 at 136,214,402 bp
  • T to C, chromosome 1 at 155,201,991 bp
  • A to G, chromosome 1 at 170,649,782 bp
  • C to T, chromosome 2 at 121,535,582 bp
  • T to G, chromosome 2 at 125,412,749 bp
  • T to C, chromosome 2 at 148,700,425 bp
  • A to T, chromosome 2 at 154,523,919 bp
  • A to G, chromosome 3 at 90,276,397 bp
  • A to G, chromosome 3 at 145,148,932 bp
  • G to T, chromosome 4 at 43,512,439 bp
  • T to C, chromosome 4 at 126,058,739 bp
  • T to A, chromosome 4 at 148,570,401 bp
  • A to T, chromosome 5 at 104,327,073 bp
  • C to T, chromosome 5 at 119,838,720 bp
  • T to A, chromosome 5 at 144,816,409 bp
  • A to T, chromosome 7 at 19,976,097 bp
  • A to G, chromosome 7 at 29,086,109 bp
  • A to T, chromosome 7 at 51,570,421 bp
  • T to C, chromosome 7 at 107,624,817 bp
  • T to C, chromosome 8 at 70,852,688 bp
  • T to C, chromosome 9 at 54,027,476 bp
  • A to G, chromosome 9 at 56,925,985 bp
  • T to C, chromosome 11 at 3,530,021 bp
  • A to G, chromosome 11 at 59,743,814 bp
  • A to T, chromosome 11 at 67,192,525 bp
  • A to G, chromosome 11 at 86,799,484 bp
  • T to C, chromosome 11 at 120,378,340 bp
  • T to A, chromosome 12 at 58,213,620 bp
  • G to T, chromosome 12 at 83,548,051 bp
  • G to T, chromosome 12 at 85,123,864 bp
  • A to G, chromosome 12 at 95,778,953 bp
  • A to G, chromosome 13 at 23,747,159 bp
  • ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG to ACAGCAGCAGCAGCAGCAGCAGCAGCAG, chromosome 13 at 38,346,250 bp
  • T to C, chromosome 13 at 67,256,209 bp
  • G to A, chromosome 13 at 112,917,622 bp
  • G to A, chromosome 14 at 33,932,753 bp
  • G to T, chromosome 14 at 56,028,668 bp
  • C to T, chromosome 15 at 25,138,938 bp
  • T to A, chromosome 15 at 75,158,512 bp
  • G to A, chromosome 15 at 82,022,941 bp
  • C to T, chromosome 15 at 82,064,152 bp
  • A to G, chromosome 16 at 37,029,446 bp
  • A to G, chromosome 16 at 38,298,133 bp
  • G to T, chromosome 17 at 15,725,312 bp
  • G to A, chromosome 17 at 33,884,711 bp
  • A to G, chromosome 18 at 12,064,214 bp
  • T to C, chromosome 18 at 37,413,161 bp
  • T to A, chromosome 18 at 49,893,611 bp
  • A to G, chromosome 19 at 9,015,619 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1218 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039287-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.