Strain Name:
C57BL/6J-MtgxR1929Btlr/Mmmh
Stock Number:
039947-MU
Citation ID:
RRID:MMRRC_039947-MU
Other Names:
R1929 (G1), C57BL/6J-MtgxR1929Btlr
Major Collection:

Strain Information

Matr3
Name: matrin 3
Synonyms: 2810017I02Rik, 1110061A14Rik, D030046F20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 17184
HGNC: HGNC:6912
Homologene: 7830
Cdk17
Name: cyclin dependent kinase 17
Synonyms: Pctk2, 6430598J10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 237459
VEGA: 10
HGNC: HGNC:8750
Homologene: 55666
Ntrk3
Name: neurotrophic tyrosine kinase, receptor, type 3
Synonyms: TrkC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18213
HGNC: HGNC:8033
Homologene: 49183
Erbb4
Name: erb-b2 receptor tyrosine kinase 4
Synonyms: Her4, ErbB4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13869
HGNC: HGNC:3432
Homologene: 21084
Sez6
Name: seizure related gene 6
Synonyms: sez-6, D11Bhm177e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 20370
Homologene: 10948
Btc
Name: betacellulin, epidermal growth factor family member
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 12223
HGNC: HGNC:1121
Homologene: 1309
Ddc
Name: dopa decarboxylase
Synonyms: aromatic L-amino acid decarboxylase, Aadc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 13195
HGNC: HGNC:2719
Homologene: 618
Shc1
Name: src homology 2 domain-containing transforming protein C1
Synonyms: p66, ShcA, p66shc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 20416
Homologene: 7934
Adcy10
Name: adenylate cyclase 10
Synonyms: 4930431D04Rik, sAC, Sacy, soluble adenylyl cyclase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 271639
Homologene: 10188
Prrc1
Name: proline-rich coiled-coil 1
Synonyms: 1190002C06Rik, 2310058D16Rik, 3110038B19Rik, 9430085A19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 73137
VEGA: 18
Homologene: 12491
Usp7
Name: ubiquitin specific peptidase 7
Synonyms: 2210010O09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 252870
Homologene: 2592
Ndufv1
Name: NADH:ubiquinone oxidoreductase core subunit V1
Synonyms: 24 kDa (FP)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 17995
HGNC: HGNC:7716
Homologene: 5151
Prkdc
Name: protein kinase, DNA activated, catalytic polypeptide
Synonyms: DNA-PK, dxnph, DNAPDcs, slip, DOXNPH, XRCC7, DNA-PKcs
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 19090
HGNC: HGNC:9413
Homologene: 5037
Cenpv
Name: centromere protein V
Synonyms: Prr6, 3110013H01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 73139
Homologene: 42965
Rgs3
Name: regulator of G-protein signaling 3
Synonyms: PDZ-RGS3, RGS3S, C2PA-RGS3, 4930506N09Rik, C2pa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 50780
HGNC: HGNC:9999
Homologene: 32440
Rngtt
Name: RNA guanylyltransferase and 5'-phosphatase
Synonyms: mouse capping enzyme
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 24018
Homologene: 37851
Cyfip1
Name: cytoplasmic FMR1 interacting protein 1
Synonyms: Shyc, Sra-1, l7Rl1, P140SRA-1, l(7)1Rl, E030028J09Rik, pl-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 20430
Homologene: 22628
Med13l
Name: mediator complex subunit 13-like
Synonyms: Thrap2, Trap240L, 6330591G05Rik, 9030618F05Rik, 2210413I17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 76199
Homologene: 25256
Suclg2
Name: succinate-Coenzyme A ligase, GDP-forming, beta subunit
Synonyms: D6Wsu120e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 20917
Homologene: 2854
Zfp568
Name: zinc finger protein 568
Synonyms: LOC381866, chato
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 243905
Homologene: 136307
Specc1l
Name: sperm antigen with calponin homology and coiled-coil domains 1-like
Synonyms: 4932439K10Rik, 9530057A13Rik, Cytsa, 4930470P14Rik, Specc1l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 74392
VEGA: 10
Homologene: 15610
Apbb2
Name: amyloid beta precursor protein binding family B member 2
Synonyms: 2310007D03Rik, TR2L, Zfra, FE65L1, Rirl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 11787
HGNC: HGNC:582
Homologene: 32079
Ankrd12
Name: ankyrin repeat domain 12
Synonyms: GAC-1, ANCO-2, 2900001A12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 106585
Homologene: 9059
Rab3gap2
Name: RAB3 GTPase activating protein subunit 2
Synonyms: 1110059F07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 98732
Homologene: 40842
Fry
Name: FRY microtubule binding protein
Synonyms: 9330186A19Rik, cg003
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 320365
Homologene: 113770
Rnf40
Name: ring finger protein 40
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233900
Homologene: 8856
Dop1a
Name: DOP1 leucine zipper like protein A
Synonyms: B130005I07Rik, Dopey1, D9Ertd809e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 320615
Homologene: 26645
Emsy
Name: EMSY, BRCA2-interacting transcriptional repressor
Synonyms: 2210018M11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233545
Homologene: 32465
Mki67
Name: antigen identified by monoclonal antibody Ki 67
Synonyms: Ki-67, Ki67, D630048A14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 17345
HGNC: HGNC:7107
Homologene: 1814
Focad
Name: focadhesin
Synonyms: BC057079
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230393
Homologene: 9842
Carnmt1
Name: carnosine N-methyltransferase 1
Synonyms: 2410127L17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 67383
VEGA: 19
Homologene: 6806
Bnip3
Name: BCL2/adenovirus E1B interacting protein 3
Synonyms: Nip3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 12176
HGNC: HGNC:1084
Homologene: 2990
Itpr1
Name: inositol 1,4,5-trisphosphate receptor 1
Synonyms: Pcp1, Ip3r, P400, wblo, InsP3R type I, Pcp-1, opt, Itpr-1, IP3R1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 16438
HGNC: HGNC:6180
Homologene: 1673
Atp13a1
Name: ATPase type 13A1
Synonyms: catp, Cgi152, Atp13a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 170759
VEGA: 8
Homologene: 5791
Fgd6
Name: FYVE, RhoGEF and PH domain containing 6
Synonyms: ZFYVE24, Etohd4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 13998
Homologene: 14209
Mms22l
Name: MMS22-like, DNA repair protein
Synonyms: F730047E07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 212377
Homologene: 18874
Bcan
Name: brevican
Synonyms: Cspg7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 12032
Homologene: 7244
Spg11
Name: SPG11, spatacsin vesicle trafficking associated
Synonyms: C530005A01Rik, 6030465E24Rik, spastic paraplegia 11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 214585
Homologene: 41614
Tmem131
Name: transmembrane protein 131
Synonyms: D1Bwg0491e, Neg, Rw1, 2610524E03Rik, YR-23, CC28
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 56030
Homologene: 32428
Pigr
Name: polymeric immunoglobulin receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18703
HGNC: HGNC:8968
Homologene: 1984
Zfp799
Name: zinc finger protein 799
Synonyms: 6030490I01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 240064
Homologene: 107106
Zfp451
Name: zinc finger protein 451
Synonyms: 4933435G09Rik, 4930515K21Rik, Kiaa0576-hp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 98403
Homologene: 9188
Elac2
Name: elaC ribonuclease Z 2
Synonyms: tRNase Z(L), 1110017O07Rik, D11Wsu80e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 68626
Homologene: 6403
Pes1
Name: pescadillo ribosomal biogenesis factor 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 64934
HGNC: HGNC:8848
Homologene: 5984
Ncbp2
Name: nuclear cap binding protein subunit 2
Synonyms: 20kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 68092
HGNC: HGNC:7659
Homologene: 56377
Cd2bp2
Name: CD2 cytoplasmic tail binding protein 2
Synonyms: 2410024K20Rik, 1500011B02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 70233
HGNC: HGNC:1656
Homologene: 4455
Pkd1l1
Name: polycystic kidney disease 1 like 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 171395
Homologene: 51376
Efcab6
Name: EF-hand calcium binding domain 6
Synonyms: 4931407K02Rik, 4932408N08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 77627
Homologene: 11259
Dnah3
Name: dynein, axonemal, heavy chain 3
Synonyms: Dnahc3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 381917
HGNC: HGNC:2949
Homologene: 19674
Trim58
Name: tripartite motif-containing 58
Synonyms: LOC386443, LOC216781
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216781
Homologene: 9135
Irs1
Name: insulin receptor substrate 1
Synonyms: IRS-1, G972R
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16367
HGNC: HGNC:6125
Homologene: 4049
Dnah9
Name: dynein, axonemal, heavy chain 9
Synonyms: Dnahc9, D11Ertd686e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237806
HGNC: HGNC:2953
Homologene: 20357
Zfp804b
Name: zinc finger protein 804B
Synonyms: LOC207618
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 207618
Homologene: 52304
Stx18
Name: syntaxin 18
Synonyms: 1810035L21Rik, 4933425D03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 71116
Homologene: 9655
Slc26a2
Name: solute carrier family 26 (sulfate transporter), member 2
Synonyms: Dtd, ST-OB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 13521
Homologene: 73876
Des
Name: desmin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13346
HGNC: HGNC:2770
Homologene: 56469
Samd3
Name: sterile alpha motif domain containing 3
Synonyms: LOC268288
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 268288
VEGA: 10
Homologene: 67991
Rhobtb2
Name: Rho-related BTB domain containing 2
Synonyms: Dbc2, E130206H14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 246710
VEGA: 14
Homologene: 22873
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: E130113P14Rik, bl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231470
Homologene: 23516
Gm5698
Name: predicted gene 5698
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 435615
Dis3l
Name: DIS3 like exosome 3'-5' exoribonuclease
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 213550
Homologene: 15797
Unc5d
Name: unc-5 netrin receptor D
Synonyms: Unc5h4, D930029E11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 210801
Homologene: 15450
Lipa
Name: lysosomal acid lipase A
Synonyms: Lip-1, Lip1, Lal
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 16889
VEGA: 19
HGNC: HGNC:6617
Homologene: 37277
Myo5b
Name: myosin VB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 17919
HGNC: HGNC:7603
Homologene: 49481
Or1e1c
Name: olfactory receptor family 1 subfamily E member 1C
Synonyms: MOR135-12, GA_x6K02T2P1NL-3535075-3536028, Olfr376
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 258924
Homologene: 133579
Ttc19
Name: tetratricopeptide repeat domain 19
Synonyms: 2810460C24Rik, 2010204O13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 72795
Homologene: 9831
Tctn2
Name: tectonic family member 2
Synonyms: 4432405B04Rik, Tect2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 67978
Homologene: 11729
Filip1
Name: filamin A interacting protein 1
Synonyms: FILIP, 5730485H21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 70598
Homologene: 6700
Or8b12i
Name: olfactory receptor family 8 subfamily B member 12I
Synonyms: Olfr870, GA_x6K02T2PVTD-13912679-13911744, MOR141-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 57251
Homologene: 138319
Cracr2a
Name: calcium release activated channel regulator 2A
Synonyms: LOC381812, Efcab4b, LOC243645
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 381812
Homologene: 41883
Cdhr18
Name: cadherin related family member 18
Synonyms: LOC238939, Gm281
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 238939
Homologene: 141164
Plxnb1
Name: plexin B1
Synonyms: 2900002G15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235611
HGNC: HGNC:9103
Homologene: 130508
Per3
Name: period circadian clock 3
Synonyms: mPer3, 2810049O06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 18628
HGNC: HGNC:8847
Homologene: 7886
Serpina3m
Name: serine (or cysteine) peptidase inhibitor, clade A, member 3M
Synonyms: contrapsin-like, Spi2-rs1, MMSPi2.4, Spi2.4, MMCM7, 3e46, Spi-2l, Spi-2rs1, antitrypsin, alpha-1 antiproteinase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 20717
HGNC: HGNC:16
Homologene: 111129
Gsdma
Name: gasdermin A
Synonyms: Gsdm, H312E, Gsdm1, Gsdma1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 57911
Homologene: 10962
P4ha1
Name: procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha 1 polypeptide
Synonyms: P4ha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 18451
HGNC: HGNC:8546
Homologene: 30998
Garin5b
Name: golgi associated RAB2 interactor family member 5B
Synonyms: 4930401F20Rik, Fam71e2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 243822
Homologene: 89225
Ccdc83
Name: coiled-coil domain containing 83
Synonyms: 4932423M01Rik, 4930554C01Rik, 4930549K11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 75338
Homologene: 32709
Msh5
Name: mutS homolog 5
Synonyms: Mut5, G7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 17687
HGNC: HGNC:7328
Homologene: 8415
Cdc20b
Name: cell division cycle 20B
Synonyms: EG238896, EG622422
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 238896
Homologene: 65056
Gbp2
Name: guanylate binding protein 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 14469
Homologene: 10289
Fmo1
Name: flavin containing monooxygenase 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 14261
HGNC: HGNC:3769
Homologene: 55520
Vmn2r16
Name: vomeronasal 2, receptor 16
Synonyms: EG384220
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 384220
Homologene: 104825
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: C130090D05Rik, Kv12.1, ELK1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 211468
Homologene: 14332
Plch1
Name: phospholipase C, eta 1
Synonyms: PLCeta1, Plcl3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 269437
Homologene: 88833
Hkdc1
Name: hexokinase domain containing 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216019
Homologene: 128937
Zfp938
Name: zinc finger protein 938
Synonyms: B230315N10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 237411
Homologene: 135924
Sec61a2
Name: SEC61 translocon subunit alpha 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 57743
Homologene: 38481
Kcnk16
Name: potassium channel, subfamily K, member 16
Synonyms: 4731413G05Rik, TALK1, TALK-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 74571
VEGA: 14
Homologene: 75328
Mfsd11
Name: major facilitator superfamily domain containing 11
Synonyms: 2600014M03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 69900
Homologene: 11517
Zfp444
Name: zinc finger protein 444
Synonyms: 2810031J10Rik, 6230401O10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 72667
Homologene: 10139
Arid3c
Name: AT-rich interaction domain 3C
Synonyms: OTTMUSG00000006683
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 550619
Homologene: 72499
Cyp27b1
Name: cytochrome P450, family 27, subfamily b, polypeptide 1
Synonyms: Pddr, 25(OH)D 1alpha-hydroxylase, 1alpha(OH)ase, P450VD1alpha, 25-hydroxyvitamin D3 1alpha-hydroxylase, Cyp40, Cp2b, Cyp1, Vdd1, Vddr, Cyp27b, P450c1, VddrI
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 13115
HGNC: HGNC:2606
Homologene: 37139
Angel1
Name: angel homolog 1
Synonyms: 1110030H02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 68737
Homologene: 32251
Dtx3l
Name: deltex 3-like, E3 ubiquitin ligase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 209200
Homologene: 51375
Fmo4
Name: flavin containing monooxygenase 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226564
HGNC: HGNC:3772
Homologene: 68219
Amdhd2
Name: amidohydrolase domain containing 2
Synonyms: 5730457F11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 245847
Homologene: 9311
Serpinb13
Name: serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 13
Synonyms: PI13, HURPIN, HUR7, headpin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 241196
HGNC: HGNC:8944
Homologene: 22718
Or4a15
Name: olfactory receptor family 4 subfamily A member 15
Synonyms: GA_x6K02T2Q125-50805620-50804676, MOR231-2, Olfr1234
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258975
Homologene: 128156
Tram1l1
Name: translocation associated membrane protein 1-like 1
Synonyms: A830091N21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229801
Homologene: 17142
Chst11
Name: carbohydrate sulfotransferase 11
Synonyms: 1110020P09Rik, C4ST-1, chondroitin 4, C4ST1, C4ST
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 58250
Homologene: 56808
Psma5-ps
Name: proteasome subunit alpha 5, pseudogene
Synonyms: Gm8394
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 666974
VEGA: 10
Gngt2
Name: guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 14710
HGNC: HGNC:4412
Homologene: 11325
Gm10076
Name: predicted gene 10076
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 100126819
VEGA: 14
Zfp729b
Name: zinc finger protein 729b
Synonyms: AA987161
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 100416706
Homologene: 133713
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to G, chromosome 1 at 30,977,961 bp
  • A to G, chromosome 1 at 33,782,193 bp
  • G to A, chromosome 1 at 33,783,856 bp
  • A to G, chromosome 1 at 36,812,271 bp
  • T to C, chromosome 1 at 68,198,888 bp
  • T to G, chromosome 1 at 75,363,493 bp
  • T to C, chromosome 1 at 82,288,459 bp
  • A to T, chromosome 1 at 106,999,026 bp
  • G to A, chromosome 1 at 130,846,662 bp
  • A to T, chromosome 1 at 162,799,047 bp
  • A to T, chromosome 1 at 162,833,855 bp
  • A to T, chromosome 1 at 165,510,297 bp
  • T to A, chromosome 1 at 185,283,542 bp
  • A to G, chromosome 2 at 5,873,736 bp
  • A to G, chromosome 2 at 89,363,009 bp
  • C to T, chromosome 2 at 122,060,207 bp
  • T to A, chromosome 3 at 63,744,535 bp
  • T to A, chromosome 3 at 87,993,094 bp
  • G to A, chromosome 3 at 89,423,542 bp
  • T to A, chromosome 3 at 124,321,986 bp
  • G to A, chromosome 3 at 142,630,178 bp
  • T to C, chromosome 4 at 24,535,936 bp
  • T to A, chromosome 4 at 33,500,302 bp
  • T to A, chromosome 4 at 41,724,744 bp
  • A to G, chromosome 4 at 62,702,147 bp
  • A to G, chromosome 4 at 88,342,212 bp
  • A to G, chromosome 4 at 88,397,179 bp
  • G to A, chromosome 4 at 143,654,142 bp
  • T to A, chromosome 4 at 151,018,885 bp
  • A to G, chromosome 5 at 6,769,748 bp
  • T to A, chromosome 5 at 38,128,039 bp
  • T to A, chromosome 5 at 66,307,615 bp
  • T to C, chromosome 5 at 91,362,401 bp
  • T to C, chromosome 5 at 96,667,437 bp
  • A to G, chromosome 5 at 109,339,258 bp
  • T to G, chromosome 5 at 118,728,833 bp
  • A to T, chromosome 5 at 124,602,199 bp
  • A to G, chromosome 5 at 150,400,924 bp
  • T to C, chromosome 6 at 95,589,094 bp
  • T to A, chromosome 6 at 108,493,755 bp
  • T to A, chromosome 6 at 127,607,298 bp
  • T to A, chromosome 7 at 4,758,187 bp
  • T to C, chromosome 7 at 6,189,555 bp
  • T to A, chromosome 7 at 29,989,122 bp
  • G to T, chromosome 7 at 55,899,957 bp
  • A to C, chromosome 7 at 78,516,723 bp
  • C to T, chromosome 7 at 90,224,077 bp
  • T to G, chromosome 7 at 98,626,623 bp
  • T to A, chromosome 7 at 119,975,129 bp
  • T to C, chromosome 7 at 127,193,878 bp
  • T to C, chromosome 7 at 127,591,784 bp
  • C to T, chromosome 7 at 135,698,065 bp
  • T to G, chromosome 7 at 138,894,630 bp
  • A to T, chromosome 8 at 28,694,756 bp
  • T to C, chromosome 8 at 69,797,164 bp
  • T to A, chromosome 9 at 20,171,409 bp
  • T to A, chromosome 9 at 64,330,883 bp
  • T to C, chromosome 9 at 79,819,930 bp
  • T to G, chromosome 9 at 86,494,418 bp
  • T to C, chromosome 9 at 109,102,708 bp
  • A to G, chromosome 10 at 26,263,986 bp
  • A to G, chromosome 10 at 59,371,037 bp
  • T to C, chromosome 10 at 62,417,898 bp
  • C to T, chromosome 10 at 75,245,604 bp
  • C to T, chromosome 10 at 82,225,547 bp
  • T to C, chromosome 10 at 83,191,170 bp
  • A to G, chromosome 10 at 85,313,731 bp
  • T to C, chromosome 10 at 93,228,678 bp
  • T to C, chromosome 10 at 94,045,006 bp
  • T to A, chromosome 10 at 127,048,312 bp
  • C to A, chromosome 11 at 3,969,524 bp
  • A to T, chromosome 11 at 8,836,197 bp
  • T to C, chromosome 11 at 11,835,764 bp
  • T to A, chromosome 11 at 58,640,667 bp
  • A to G, chromosome 11 at 62,281,824 bp
  • T to C, chromosome 11 at 62,525,233 bp
  • T to A, chromosome 11 at 64,979,189 bp
  • T to C, chromosome 11 at 65,976,398 bp
  • T to A, chromosome 11 at 73,375,601 bp
  • C to T, chromosome 11 at 77,972,932 bp
  • C to T, chromosome 11 at 95,845,146 bp
  • T to C, chromosome 11 at 98,671,367 bp
  • T to C, chromosome 11 at 116,873,914 bp
  • A to C, chromosome 12 at 86,702,319 bp
  • G to A, chromosome 12 at 104,389,322 bp
  • A to T, chromosome 13 at 67,592,233 bp
  • A to G, chromosome 13 at 113,071,917 bp
  • T to A, chromosome 14 at 13,845,484 bp
  • A to G, chromosome 14 at 20,265,279 bp
  • T to G, chromosome 14 at 69,796,444 bp
  • T to G, chromosome 14 at 105,681,870 bp
  • A to G, chromosome 15 at 83,892,962 bp
  • T to C, chromosome 16 at 8,698,469 bp
  • A to G, chromosome 16 at 15,654,817 bp
  • T to C, chromosome 16 at 31,956,951 bp
  • A to T, chromosome 16 at 35,933,689 bp
  • T to C, chromosome 17 at 24,157,886 bp
  • A to G, chromosome 17 at 32,821,803 bp
  • A to G, chromosome 17 at 35,044,390 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • G to A, chromosome 17 at 65,986,686 bp
  • T to A, chromosome 18 at 35,588,325 bp
  • G to T, chromosome 18 at 57,381,646 bp
  • A to G, chromosome 18 at 61,198,578 bp
  • G to T, chromosome 18 at 74,733,925 bp
  • C to A, chromosome 19 at 4,008,347 bp
  • T to C, chromosome 19 at 18,703,370 bp
  • T to A, chromosome 19 at 34,510,890 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1929 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039947-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.