Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1929Btlr/Mmmh
Stock Number:
039947-MU
Citation ID:
RRID:MMRRC_039947-MU
Other Names:
R1929 (G1), C57BL/6J-MtgxR1929Btlr
Major Collection:

Strain Information

Matr3
Name: matrin 3
Synonyms: D030046F20Rik, 2810017I02Rik, 1110061A14Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 17184
HGNC: HGNC:6912
Homologene: 7830
Cdk17
Name: cyclin dependent kinase 17
Synonyms: 6430598J10Rik, Pctk2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237459
VEGA: 10
HGNC: HGNC:8750
Homologene: 55666
Ntrk3
Name: neurotrophic tyrosine kinase, receptor, type 3
Synonyms: TrkC
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18213
HGNC: HGNC:8033
Homologene: 49183
Erbb4
Name: erb-b2 receptor tyrosine kinase 4
Synonyms: ErbB4, Her4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13869
HGNC: HGNC:3432
Homologene: 21084
Sez6
Name: seizure related gene 6
Synonyms: sez-6, D11Bhm177e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20370
Homologene: 10948
Btc
Name: betacellulin, epidermal growth factor family member
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12223
HGNC: HGNC:1121
Homologene: 1309
Ddc
Name: dopa decarboxylase
Synonyms: aromatic L-amino acid decarboxylase, Aadc
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13195
HGNC: HGNC:2719
Homologene: 618
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to G, chromosome 1 at 30,977,961 bp
  • A to G, chromosome 1 at 33,782,193 bp
  • G to A, chromosome 1 at 33,783,856 bp
  • A to G, chromosome 1 at 36,812,271 bp
  • T to C, chromosome 1 at 68,198,888 bp
  • T to G, chromosome 1 at 75,363,493 bp
  • T to C, chromosome 1 at 82,288,459 bp
  • A to T, chromosome 1 at 106,999,026 bp
  • G to A, chromosome 1 at 130,846,662 bp
  • A to T, chromosome 1 at 162,799,047 bp
  • A to T, chromosome 1 at 162,833,855 bp
  • A to T, chromosome 1 at 165,510,297 bp
  • T to A, chromosome 1 at 185,283,542 bp
  • A to G, chromosome 2 at 5,873,736 bp
  • A to G, chromosome 2 at 89,363,009 bp
  • C to T, chromosome 2 at 122,060,207 bp
  • T to A, chromosome 3 at 63,744,535 bp
  • T to A, chromosome 3 at 87,993,094 bp
  • G to A, chromosome 3 at 89,423,542 bp
  • T to A, chromosome 3 at 124,321,986 bp
  • G to A, chromosome 3 at 142,630,178 bp
  • T to C, chromosome 4 at 24,535,936 bp
  • T to A, chromosome 4 at 33,500,302 bp
  • T to A, chromosome 4 at 41,724,744 bp
  • A to G, chromosome 4 at 62,702,147 bp
  • A to G, chromosome 4 at 88,342,212 bp
  • A to G, chromosome 4 at 88,397,179 bp
  • G to A, chromosome 4 at 143,654,142 bp
  • T to A, chromosome 4 at 151,018,885 bp
  • A to G, chromosome 5 at 6,769,748 bp
  • T to A, chromosome 5 at 38,128,039 bp
  • T to A, chromosome 5 at 66,307,615 bp
  • T to C, chromosome 5 at 91,362,401 bp
  • T to C, chromosome 5 at 96,667,437 bp
  • A to G, chromosome 5 at 109,339,258 bp
  • T to G, chromosome 5 at 118,728,833 bp
  • A to T, chromosome 5 at 124,602,199 bp
  • A to G, chromosome 5 at 150,400,924 bp
  • T to C, chromosome 6 at 95,589,094 bp
  • T to A, chromosome 6 at 108,493,755 bp
  • T to A, chromosome 6 at 127,607,298 bp
  • T to A, chromosome 7 at 4,758,187 bp
  • T to C, chromosome 7 at 6,189,555 bp
  • T to A, chromosome 7 at 29,989,122 bp
  • G to T, chromosome 7 at 55,899,957 bp
  • A to C, chromosome 7 at 78,516,723 bp
  • C to T, chromosome 7 at 90,224,077 bp
  • T to G, chromosome 7 at 98,626,623 bp
  • T to A, chromosome 7 at 119,975,129 bp
  • T to C, chromosome 7 at 127,193,878 bp
  • T to C, chromosome 7 at 127,591,784 bp
  • C to T, chromosome 7 at 135,698,065 bp
  • T to G, chromosome 7 at 138,894,630 bp
  • A to T, chromosome 8 at 28,694,756 bp
  • T to C, chromosome 8 at 69,797,164 bp
  • T to A, chromosome 9 at 20,171,409 bp
  • T to A, chromosome 9 at 64,330,883 bp
  • T to C, chromosome 9 at 79,819,930 bp
  • T to G, chromosome 9 at 86,494,418 bp
  • T to C, chromosome 9 at 109,102,708 bp
  • A to G, chromosome 10 at 26,263,986 bp
  • A to G, chromosome 10 at 59,371,037 bp
  • T to C, chromosome 10 at 62,417,898 bp
  • C to T, chromosome 10 at 75,245,604 bp
  • C to T, chromosome 10 at 82,225,547 bp
  • T to C, chromosome 10 at 83,191,170 bp
  • A to G, chromosome 10 at 85,313,731 bp
  • T to C, chromosome 10 at 93,228,678 bp
  • T to C, chromosome 10 at 94,045,006 bp
  • T to A, chromosome 10 at 127,048,312 bp
  • C to A, chromosome 11 at 3,969,524 bp
  • A to T, chromosome 11 at 8,836,197 bp
  • T to C, chromosome 11 at 11,835,764 bp
  • T to A, chromosome 11 at 58,640,667 bp
  • A to G, chromosome 11 at 62,281,824 bp
  • T to C, chromosome 11 at 62,525,233 bp
  • T to A, chromosome 11 at 64,979,189 bp
  • T to C, chromosome 11 at 65,976,398 bp
  • T to A, chromosome 11 at 73,375,601 bp
  • C to T, chromosome 11 at 77,972,932 bp
  • C to T, chromosome 11 at 95,845,146 bp
  • T to C, chromosome 11 at 98,671,367 bp
  • T to C, chromosome 11 at 116,873,914 bp
  • A to C, chromosome 12 at 86,702,319 bp
  • G to A, chromosome 12 at 104,389,322 bp
  • A to T, chromosome 13 at 67,592,233 bp
  • A to G, chromosome 13 at 113,071,917 bp
  • T to A, chromosome 14 at 13,845,484 bp
  • A to G, chromosome 14 at 20,265,279 bp
  • T to G, chromosome 14 at 69,796,444 bp
  • T to G, chromosome 14 at 105,681,870 bp
  • A to G, chromosome 15 at 83,892,962 bp
  • T to C, chromosome 16 at 8,698,469 bp
  • A to G, chromosome 16 at 15,654,817 bp
  • T to C, chromosome 16 at 31,956,951 bp
  • A to T, chromosome 16 at 35,933,689 bp
  • T to C, chromosome 17 at 24,157,886 bp
  • A to G, chromosome 17 at 32,821,803 bp
  • A to G, chromosome 17 at 35,044,390 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • G to A, chromosome 17 at 65,986,686 bp
  • T to A, chromosome 18 at 35,588,325 bp
  • G to T, chromosome 18 at 57,381,646 bp
  • A to G, chromosome 18 at 61,198,578 bp
  • G to T, chromosome 18 at 74,733,925 bp
  • C to A, chromosome 19 at 4,008,347 bp
  • T to C, chromosome 19 at 18,703,370 bp
  • T to A, chromosome 19 at 34,510,890 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1929 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039947-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.