Strain Name:
C57BL/6J-MtgxR2131Btlr/Mmmh
Stock Number:
040134-MU
Citation ID:
RRID:MMRRC_040134-MU
Other Names:
R2131 (G1), C57BL/6J-MtgxR2131Btlr
Major Collection:

Gene Information

Sept4
Name: septin 4
Synonyms: Bh5, cell division control-related protein 2b, ARTS, Pnutl2, septin H5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 18952
HGNC: HGNC:9165
Homologene: 6107
Ntrk3
Name: neurotrophic tyrosine kinase, receptor, type 3
Synonyms: TrkC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 18213
HGNC: HGNC:8033
Homologene: 49183
Eya1
Name: EYA transcriptional coactivator and phosphatase 1
Synonyms: bor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 14048
HGNC: HGNC:3519
Homologene: 74943
Sort1
Name: sortilin 1
Synonyms: Ntr3, neurotensin receptor 3, 2900053A11Rik, sortilin, Ntsr3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 20661
Homologene: 136097
Pzp
Name: PZP, alpha-2-macroglobulin like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 11287
HGNC: null
Homologene: 104112
Il4i1
Name: interleukin 4 induced 1
Synonyms: H-46, H-4, H4, Fig1, Fig1-ps, H46
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 14204
Homologene: 22567
Gli2
Name: GLI-Kruppel family member GLI2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 14633
HGNC: HGNC:4318
Homologene: 12725
Cdkn2c
Name: cyclin dependent kinase inhibitor 2C
Synonyms: p18INK4c, p18, INK4c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 12580
HGNC: HGNC:1789
Homologene: 966
Dnmbp
Name: dynamin binding protein
Synonyms: Tuba, 2410003M15Rik, 2410003L07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 71972
Homologene: 9061
Aopep
Name: aminopeptidase O
Synonyms: ApO, 2010111I01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 72061
HGNC: HGNC:1361
Homologene: 66273
Tti1
Name: TELO2 interacting protein 1
Synonyms: 2610036D13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 75425
Homologene: 40969
Gpr19
Name: G protein-coupled receptor 19
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 14760
HGNC: HGNC:4473
Homologene: 4476
Mnx1
Name: motor neuron and pancreas homeobox 1
Synonyms: HB9, MNR2, Hlxb9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 15285
HGNC: HGNC:4979
Homologene: 21137
Lrp5
Name: low density lipoprotein receptor-related protein 5
Synonyms: LRP7, LR3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 16973
HGNC: HGNC:6697
Homologene: 1746
Wasf1
Name: WAS protein family, member 1
Synonyms: Scar, WAVE, WAVE-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 83767
Homologene: 2920
Stk24
Name: serine/threonine kinase 24
Synonyms: STE20, 1810013H02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 223255
VEGA: 14
Homologene: 20793
Tacr3
Name: tachykinin receptor 3
Synonyms: Tac3r, neuromedin K receptor, Nk3r
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 21338
Homologene: 824
Vps35l
Name: VPS35 endosomal protein sorting factor like
Synonyms: Vsp35l, 9030624J02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 71517
Homologene: 10659
Depdc5
Name: DEP domain containing 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 277854
Homologene: 34718
Adgrl2
Name: adhesion G protein-coupled receptor L2
Synonyms: Lphh1, Lec1, Lphn2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 99633
Homologene: 22712
Anln
Name: anillin, actin binding protein
Synonyms: Scraps, 1110037A17Rik, 2900037I21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 68743
VEGA: 9
Homologene: 41281
Cad
Name: carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Synonyms: 2410008J01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 69719
HGNC: HGNC:1424
Homologene: 1412
Tacc2
Name: transforming, acidic coiled-coil containing protein 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 57752
Homologene: 5087
Pi4ka
Name: phosphatidylinositol 4-kinase alpha
Synonyms: Pik4ca
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 224020
HGNC: HGNC:8983
Homologene: 11171
Akap13
Name: A kinase (PRKA) anchor protein 13
Synonyms: 1700026G02Rik, 5830460E08Rik, 5730522G15Rik, AKAP-Lbc, PROTO-LBC, PROTO-LB, Ht31
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 75547
HGNC: HGNC:371
Homologene: 4903
Med4
Name: mediator complex subunit 4
Synonyms: HSPC126, MED4, TRAP36, Vdrip, 2410046H15Rik, DRIP36, p36 TRAP/SMCC/PC2 subunit
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 67381
VEGA: 14
Homologene: 8568
Ptpn11
Name: protein tyrosine phosphatase, non-receptor type 11
Synonyms: Syp, Shp2, SHP-2, SH-PTP2, PTP1D, PTP2C, SH2 domain-containing protein tyrosine phosphatase-2, 2700084A17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 19247
HGNC: HGNC:9644
Homologene: 2122
Lmtk2
Name: lemur tyrosine kinase 2
Synonyms: 2900041G10Rik, AATYK2, KPI-2, cprk, KPI2, A330101P12Rik, BREK
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 231876
Homologene: 8948
Arap2
Name: ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2
Synonyms: Centd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 212285
Homologene: 9064
Mki67
Name: antigen identified by monoclonal antibody Ki 67
Synonyms: D630048A14Rik, Ki67, Ki-67
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 17345
HGNC: HGNC:7107
Homologene: 1814
Tasor
Name: transcription activation suppressor
Synonyms: D14Abb1e, 4933409E02Rik, MommeD6, Fam208a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 218850
VEGA: 14
Homologene: 9062
Nbr1
Name: NBR1, autophagy cargo receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 17966
HGNC: HGNC:6746
Homologene: 7438
Slc44a1
Name: solute carrier family 44, member 1
Synonyms: Cdw92, 2210409B22Rik, CTL1, CHTL1, 4833416H08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 100434
Homologene: 11137
Cyfip2
Name: cytoplasmic FMR1 interacting protein 2
Synonyms: Pir121, 6430511D02Rik, 1500004I01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 76884
Homologene: 7936
Ncapd3
Name: non-SMC condensin II complex, subunit D3
Synonyms: B130055D15Rik, 4632407J06Rik, 2810487N22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 78658
VEGA: 9
Homologene: 41021
Tacc1
Name: transforming, acidic coiled-coil containing protein 1
Synonyms: Tacc1, B230378H13Rik, 4833447E04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 320165
Homologene: 4575
Anapc7
Name: anaphase promoting complex subunit 7
Synonyms: APC7, prediabetic NOD sera-reactive autoantigen
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 56317
Homologene: 10512
Ipo9
Name: importin 9
Synonyms: 0710008K06Rik, Imp9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 226432
Homologene: 5874
Eps15l1
Name: epidermal growth factor receptor pathway substrate 15-like 1
Synonyms: 9830147J04Rik, Eps15R, Eps15-rs
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 13859
Homologene: 31881
Zdhhc13
Name: zinc finger, DHHC domain containing 13
Synonyms: kojak, skc4, Hip14l, 2410004E01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 243983
Homologene: 75106
Mib2
Name: mindbomb E3 ubiquitin protein ligase 2
Synonyms: Zzank1, 2210008I11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 76580
Homologene: 16062
Fam171b
Name: family with sequence similarity 171, member B
Synonyms: D430039N05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 241520
Homologene: 18462
Ndel1
Name: nudE neurodevelopment protein 1 like 1
Synonyms: mNudel, 2600006O07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 83431
Homologene: 32567
Pcx
Name: pyruvate carboxylase
Synonyms: Pc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 18563
VEGA: 19
HGNC: HGNC:8636
Homologene: 5422
Lmo7
Name: LIM domain only 7
Synonyms: FBXO20, LOC380928
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 380928
HGNC: HGNC:6646
Homologene: 83924
Syt2
Name: synaptotagmin II
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 20980
Homologene: 22516
Magel2
Name: melanoma antigen, family L, 2
Synonyms: Mage-l2, NDNL1, nM15, ns7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 27385
HGNC: HGNC:6814
Homologene: 8460
Cldn1
Name: claudin 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 12737
HGNC: HGNC:2032
Homologene: 9620
Apc
Name: APC, WNT signaling pathway regulator
Synonyms: CC1, Min
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 11789
HGNC: HGNC:583
Homologene: 30950
Htt
Name: huntingtin
Synonyms: huntingtin, IT15, HD, C430023I11Rik, htt, Hdh
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 15194
HGNC: HGNC:4851
Homologene: 1593
Vav2
Name: vav 2 oncogene
Synonyms: 2810040F13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 22325
Homologene: 2530
Brca2
Name: breast cancer 2, early onset
Synonyms: Fancd1, RAB163
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 12190
HGNC: HGNC:1101
Homologene: 41
Dapk1
Name: death associated protein kinase 1
Synonyms: 2810425C21Rik, 2310039H24Rik, DAP-Kinase, D13Ucla1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 69635
VEGA: 13
HGNC: HGNC:2674
Homologene: 3626
Ube2cbp
Name: ubiquitin-conjugating enzyme E2C binding protein
Synonyms: 2610018I03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 70348
Homologene: 18898
Gemin4
Name: gem nuclear organelle associated protein 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 276919
Homologene: 69193
Plxna2
Name: plexin A2
Synonyms: 2810428A13Rik, PlexA2, Plxn2, OCT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 18845
HGNC: HGNC:9100
Homologene: 56427
Slc9a4
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 4
Synonyms: D730009J23Rik, NHE4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 110895
Homologene: 72232
Lmo2
Name: LIM domain only 2
Synonyms: Rbtn-2, Rhom-2, Rbtn2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 16909
HGNC: HGNC:6642
Homologene: 4072
Avil
Name: advillin
Synonyms: DOC6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 11567
Homologene: 38200
Tbccd1
Name: TBCC domain containing 1
Synonyms: 5730478M09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 70573
VEGA: 16
Homologene: 32392
C8b
Name: complement component 8, beta polypeptide
Synonyms: 4930439B20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 110382
HGNC: HGNC:1353
Homologene: 48
Adamtsl3
Name: ADAMTS-like 3
Synonyms: punctin-2, 9230119C12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 269959
Homologene: 18912
Ttn
Name: titin
Synonyms: shru, connectin, mdm, 2310057K23Rik, D330041I19Rik, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, L56, 2310074I15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 22138
Homologene: 130650
Celsr1
Name: cadherin, EGF LAG seven-pass G-type receptor 1
Synonyms: Scy, crash, Adgrc1, Crsh
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 12614
VEGA: 15
HGNC: HGNC:1850
Homologene: 7665
Kdm5d
Name: lysine (K)-specific demethylase 5D
Synonyms: Jarid1d, Smcy, HY
Type: Gene
Species: Mus musculus (mouse)
Chromosome: Y
Alteration at locus: Chemically Induced
NCBI: 20592
Homologene: 55838
Klra3
Name: killer cell lectin-like receptor, subfamily A, member 3
Synonyms: Nk-2, Ly49c, NK-2.1, 5E6, Nk2, Nk2.1, Ly49C
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 16634
HGNC: null
Homologene: 110821
Insrr
Name: insulin receptor-related receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 23920
HGNC: HGNC:6093
Homologene: 56539
Dnah3
Name: dynein, axonemal, heavy chain 3
Synonyms: Dnahc3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 381917
HGNC: HGNC:2949
Homologene: 19674
Clspn
Name: claspin
Synonyms: E130314M08Rik, C85083
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 269582
Homologene: 11138
Dpyd
Name: dihydropyrimidine dehydrogenase
Synonyms: DPD, E330028L06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 99586
HGNC: HGNC:3012
Homologene: 85
Kif5c
Name: kinesin family member 5C
Synonyms: Khc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 16574
HGNC: HGNC:6325
Homologene: 56234
Plcb1
Name: phospholipase C, beta 1
Synonyms: 3110043I21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 18795
Homologene: 22876
Pcdh10
Name: protocadherin 10
Synonyms: 6430521D13Rik, OL-pc, 6430703F07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 18526
Homologene: 74967
Dbt
Name: dihydrolipoamide branched chain transacylase E2
Synonyms: D3Wsu60e, dihydrolipoyllysine-residue (2-methylpropanoyl)transferase, dihydrolipoyl transacylase, BCKAD E2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 13171
HGNC: HGNC:2698
Homologene: 1444
Slc22a21
Name: solute carrier family 22 (organic cation transporter), member 21
Synonyms: Slc22a9, Octn3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 56517
HGNC: null
Homologene: 137336
4931408C20Rik
Name: RIKEN cDNA 4931408C20 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 210940
HGNC: null
Homologene: 86827
Sarm1
Name: sterile alpha and HEAT/Armadillo motif containing 1
Synonyms: A830091I15Rik, MyD88-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 237868
Homologene: 9015
Otog
Name: otogelin
Synonyms: Otgn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 18419
HGNC: HGNC:8516
Homologene: 8421
Gbp6
Name: guanylate binding protein 6
Synonyms: Mpa2l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 100702
Homologene: 128731
Jmjd4
Name: jumonji domain containing 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 194952
Homologene: 11306
A2ml1
Name: alpha-2-macroglobulin like 1
Synonyms: BC048546, Ovos2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 232400
HGNC: null
Homologene: 45969
Zc3h7a
Name: zinc finger CCCH type containing 7 A
Synonyms: Zc3h7, A430104C18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 106205
Homologene: 8563
Aox3
Name: aldehyde oxidase 3
Synonyms: 1200011D03Rik, AOH1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 71724
Homologene: 90899
Ccdc27
Name: coiled-coil domain containing 27
Synonyms: LOC381580
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 381580
Homologene: 17596
Osbpl6
Name: oxysterol binding protein-like 6
Synonyms: 1110062M20Rik, ORP-6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 99031
Homologene: 101447
Pklr
Name: pyruvate kinase liver and red blood cell
Synonyms: Pk1, Pk-1, R-PK
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 18770
HGNC: HGNC:9020
Homologene: 37286
Plekha6
Name: pleckstrin homology domain containing, family A member 6
Synonyms: Pepp3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 240753
Homologene: 135779
Mest
Name: mesoderm specific transcript
Synonyms: Peg1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 17294
HGNC: HGNC:7028
Homologene: 1800
Kif14
Name: kinesin family member 14
Synonyms: N-3 kinesin, D1Ertd367e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 381293
Homologene: 8916
Cyp2g1
Name: cytochrome P450, family 2, subfamily g, polypeptide 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 13108
HGNC: HGNC:2633
Homologene: 75020
Tecpr1
Name: tectonin beta-propeller repeat containing 1
Synonyms: 2210010N04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 70381
Homologene: 9120
Atp8b5
Name: ATPase, class I, type 8B, member 5
Synonyms: 4930417M19Rik, FetA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 320571
Homologene: 99882
Olfml3
Name: olfactomedin-like 3
Synonyms: ONT3, mONT3, HNOEL-iso, 2810002E22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 99543
Homologene: 10613
Bap1
Name: Brca1 associated protein 1
Synonyms: 2300006C11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 104416
HGNC: HGNC:950
Homologene: 3421
Tmc6
Name: transmembrane channel-like gene family 6
Synonyms: EVER1, D11Ertd204e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 217353
Homologene: 5258
Tor1aip2
Name: torsin A interacting protein 2
Synonyms: 15kDa, LULL1, Ifrg15, 1110020D10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 240832
Homologene: 17028
Igfn1
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 226438
Homologene: 130054
Ampd1
Name: adenosine monophosphate deaminase 1
Synonyms: Ampd-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 229665
HGNC: HGNC:468
Homologene: 20
Zfp467
Name: zinc finger protein 467
Synonyms: MNCb-3350, 1190001I08Rik, EZI
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 68910
Homologene: 10758
Pcdhb14
Name: protocadherin beta 14
Synonyms: PcdhbN, 2210006M07Rik, Pcdhb17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 93885
HGNC: null
Homologene: 70876
Fam186a
Name: family with sequence similarity 186, member A
Synonyms: 1700030F18Rik, LOC380973
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 72277
Homologene: null
Clcn4
Name: chloride channel, voltage-sensitive 4
Synonyms: Clcn4-2, Clc4-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 12727
HGNC: HGNC:2022
Homologene: 68207
Col20a1
Name: collagen, type XX, alpha 1
Synonyms: 1700051I12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 73368
Homologene: 75138
Hnf4a
Name: hepatic nuclear factor 4, alpha
Synonyms: HNF4 alpha, Nr2a1, Tcf4, HNF-4, Nuclear receptor 2A1, MODY1, Tcf14, Hnf4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 15378
HGNC: HGNC:5024
Homologene: 395
Ren1
Name: renin 1 structural
Synonyms: Ren-A, Ren-1, Ren, Ren1c, Rnr, Ren1d, Rn-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 19701
HGNC: HGNC:9958
Homologene: 20151
Arsk
Name: arylsulfatase K
Synonyms: 2810429K17Rik, 4833414G15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 77041
Homologene: 12670
Ankrd16
Name: ankyrin repeat domain 16
Synonyms: D430029B21Rik, 2810455F06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 320816
Homologene: 19509
Spag6l
Name: sperm associated antigen 6-like
Synonyms: PF16, Spag6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 50525
Homologene: 8252
Capn9
Name: calpain 9
Synonyms: GC36, nCL-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 73647
HGNC: HGNC:1486
Homologene: 38208
Oosp1
Name: oocyte secreted protein 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 170834
Homologene: 87189
Rbm12
Name: RNA binding motif protein 12
Synonyms: 5730420G12Rik, SWAN, 9430070C08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 75710
HGNC: HGNC:9898
Homologene: 34993
Txk
Name: TXK tyrosine kinase
Synonyms: A130089B16Rik, Btkl, PTK4, Rlk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 22165
Homologene: 2497
Kif4-ps
Name: kinesin family member 4, pseudogene
Synonyms: Kif4b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 74947
HGNC: null
Homologene: null
Wdr27
Name: WD repeat domain 27
Synonyms: 0610012K18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 71682
VEGA: 17
Homologene: 18417
Lrrc24
Name: leucine rich repeat containing 24
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 378937
Homologene: 86785
Ro60
Name: Ro60, Y RNA binding protein
Synonyms: SS-A/Ro, A530054J02Rik, Ssa, Trove2, 1810007I17Rik, Ssa2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 20822
Homologene: 3383
Acvr2b
Name: activin receptor IIB
Synonyms: ActRIIB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 11481
VEGA: 9
HGNC: HGNC:174
Homologene: 863
Pde6b
Name: phosphodiesterase 6B, cGMP, rod receptor, beta polypeptide
Synonyms: rd, rd10, r, Pdeb, rd1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 18587
HGNC: HGNC:8786
Homologene: 237
Cfhr2
Name: complement factor H-related 2
Synonyms: FHR-B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 545366
HGNC: null
Homologene: 134349
Kcnj13
Name: potassium inwardly-rectifying channel, subfamily J, member 13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 100040591
HGNC: HGNC:6259
Homologene: 55638
Stard13
Name: StAR-related lipid transfer (START) domain containing 13
Synonyms: DLC2, GT650
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 243362
Homologene: 64844
Ldhd
Name: lactate dehydrogenase D
Synonyms: 4733401P21Rik, D8Bwg1320e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 52815
Homologene: 5536
Tjp3
Name: tight junction protein 3
Synonyms: ZO-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 27375
VEGA: 10
Homologene: 8458
Olfr775
Name: olfactory receptor 775
Synonyms: GA_x6K02T2PULF-10936819-10937757, MOR111-7, MOR111-6, Olfr1518, MOR111-7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 258538
HGNC: null
Homologene: 115559
Adra1a
Name: adrenergic receptor, alpha 1a
Synonyms: Adra1c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 11549
HGNC: HGNC:277
Homologene: 68078
Nyap1
Name: neuronal tyrosine-phosphorylated phosphoinositide 3-kinase adaptor 1
Synonyms: Nyap1, 6430598A04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 243300
Homologene: 18320
Castor2
Name: cytosolic arginine sensor for mTORC1 subunit 2
Synonyms: Gats, Gatsl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 80909
Homologene: 84866
Tnnt2
Name: troponin T2, cardiac
Synonyms: Tnt, cardiac TnT, cTnT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 21956
Homologene: 68050
Optc
Name: opticin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 269120
HGNC: HGNC:8158
Homologene: 8652
Pdcd4
Name: programmed cell death 4
Synonyms: TIS, MA-3, D19Ucla1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 18569
VEGA: 19
HGNC: HGNC:8763
Homologene: 7879
Creg2
Name: cellular repressor of E1A-stimulated genes 2
Synonyms: A830098L22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 263764
Homologene: 17827
Prelp
Name: proline arginine-rich end leucine-rich repeat
Synonyms: SLRR2A, 7330409J17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 116847
HGNC: HGNC:9357
Homologene: 2041
Mcpt8
Name: mast cell protease 8
Synonyms: MMCP-8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 17231
VEGA: 14
HGNC: null
Homologene: null
Olfr341
Name: olfactory receptor 341
Synonyms: MOR136-2, GA_x6K02T2NLDC-33174915-33173974
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 258952
HGNC: null
Homologene: 74160
Plekho1
Name: pleckstrin homology domain containing, family O member 1
Synonyms: Jza2, 2810052M02Rik, CKIP-1, JZA-20
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 67220
Homologene: 9448
Golim4
Name: golgi integral membrane protein 4
Synonyms: Golph4, 3110027H23Rik, P138, GPP130
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 73124
Homologene: 8716
Prkra
Name: protein kinase, interferon inducible double stranded RNA dependent activator
Synonyms: lear, PRK, RAX, Pact
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 23992
HGNC: HGNC:9438
Homologene: 2738
Sept12
Name: septin 12
Synonyms: 4933413B09Rik, Septin12, 1700028G04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 71089
VEGA: 16
Homologene: 69435
Gabra4
Name: gamma-aminobutyric acid (GABA) A receptor, subunit alpha 4
Synonyms: Gabra-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 14397
HGNC: HGNC:4078
Homologene: 631
Cx3cl1
Name: chemokine (C-X3-C motif) ligand 1
Synonyms: fractalkine, D8Bwg0439e, neurotactin, Scyd1, CX3C
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 20312
Homologene: 2251
Ift20
Name: intraflagellar transport 20
Synonyms: 0610009H04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 55978
Homologene: 49559
Ttc9b
Name: tetratricopeptide repeat domain 9B
Synonyms: 2900074C18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 73032
Homologene: 19938
Spag6
Name: sperm associated antigen 6
Synonyms: BC061194, Spag6l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 381350
Homologene: 133723
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 14,170,974 bp
  • T to C, chromosome 1 at 26,685,854 bp
  • T to C, chromosome 1 at 39,624,978 bp
  • T to G, chromosome 1 at 40,607,741 bp
  • A to G, chromosome 1 at 58,169,843 bp
  • A to G, chromosome 1 at 87,386,534 bp
  • A to T, chromosome 1 at 118,964,444 bp
  • C to A, chromosome 1 at 133,279,365 bp
  • C to G, chromosome 1 at 133,350,778 bp
  • A to T, chromosome 1 at 133,903,796 bp
  • C to T, chromosome 1 at 133,915,131 bp
  • ACTCTCTCT to ACTCTCTCTCT, chromosome 1 at 134,746,741 bp
  • ATCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTCCTC, chromosome 1 at 135,386,268 bp
  • A to G, chromosome 1 at 135,402,250 bp
  • TG to TGG, chromosome 1 at 135,846,761 bp
  • AGGG to AGG, chromosome 1 at 135,974,852 bp
  • CC to CCGAC, chromosome 1 at 136,490,395 bp
  • T to G, chromosome 1 at 139,831,155 bp
  • T to C, chromosome 1 at 143,760,034 bp
  • A to G, chromosome 1 at 156,065,349 bp
  • G to A, chromosome 1 at 194,644,750 bp
  • T to A, chromosome 2 at 11,783,695 bp
  • T to A, chromosome 2 at 18,733,097 bp
  • C to A, chromosome 2 at 27,299,396 bp
  • A to G, chromosome 2 at 36,480,047 bp
  • T to A, chromosome 2 at 49,758,805 bp
  • T to A, chromosome 2 at 76,586,214 bp
  • A to T, chromosome 2 at 76,647,136 bp
  • A to T, chromosome 2 at 76,832,217 bp
  • T to A, chromosome 2 at 83,879,858 bp
  • T to C, chromosome 2 at 103,981,062 bp
  • T to A, chromosome 2 at 135,325,667 bp
  • A to T, chromosome 2 at 156,095,510 bp
  • T to C, chromosome 2 at 158,000,743 bp
  • T to A, chromosome 2 at 163,547,418 bp
  • T to A, chromosome 2 at 180,992,573 bp
  • G to T, chromosome 3 at 45,432,466 bp
  • A to T, chromosome 3 at 75,908,149 bp
  • G to A, chromosome 3 at 87,810,572 bp
  • C to A, chromosome 3 at 89,142,660 bp
  • A to G, chromosome 3 at 95,989,117 bp
  • G to T, chromosome 3 at 103,094,878 bp
  • T to A, chromosome 3 at 103,735,869 bp
  • T to A, chromosome 3 at 108,351,686 bp
  • T to A, chromosome 3 at 116,539,124 bp
  • T to C, chromosome 3 at 118,674,568 bp
  • T to C, chromosome 3 at 134,932,180 bp
  • T to C, chromosome 3 at 148,890,488 bp
  • T to A, chromosome 4 at 43,370,726 bp
  • GCCC to GCCCCCCC, chromosome 4 at 53,563,246 bp
  • T to A, chromosome 4 at 104,784,394 bp
  • A to C, chromosome 4 at 109,665,063 bp
  • T to C, chromosome 4 at 126,559,909 bp
  • TTCCTCCTCCTCCTCCTCCTC to TTCCTCCTCCTCCTCCTC, chromosome 4 at 154,036,306 bp
  • C to T, chromosome 4 at 155,655,238 bp
  • T to A, chromosome 5 at 29,474,189 bp
  • T to A, chromosome 5 at 31,058,072 bp
  • T to A, chromosome 5 at 32,990,781 bp
  • A to G, chromosome 5 at 34,877,109 bp
  • T to C, chromosome 5 at 62,677,958 bp
  • G to T, chromosome 5 at 71,641,224 bp
  • T to A, chromosome 5 at 72,696,579 bp
  • T to C, chromosome 5 at 105,274,744 bp
  • A to G, chromosome 5 at 108,428,203 bp
  • G to A, chromosome 5 at 121,172,026 bp
  • T to A, chromosome 5 at 122,438,250 bp
  • G to A, chromosome 5 at 134,136,153 bp
  • A to C, chromosome 5 at 137,733,681 bp
  • C to T, chromosome 5 at 144,174,988 bp
  • T to A, chromosome 5 at 144,208,645 bp
  • A to G, chromosome 5 at 150,557,129 bp
  • T to C, chromosome 5 at 151,045,168 bp
  • C to T, chromosome 6 at 30,745,885 bp
  • A to C, chromosome 6 at 48,442,661 bp
  • T to C, chromosome 6 at 128,491,161 bp
  • T to A, chromosome 6 at 128,576,260 bp
  • A to G, chromosome 6 at 130,335,775 bp
  • T to C, chromosome 6 at 134,870,442 bp
  • A to T, chromosome 7 at 7,284,285 bp
  • A to T, chromosome 7 at 26,820,710 bp
  • T to A, chromosome 7 at 27,654,349 bp
  • G to A, chromosome 7 at 44,840,070 bp
  • A to T, chromosome 7 at 46,250,100 bp
  • T to A, chromosome 7 at 48,824,644 bp
  • A to T, chromosome 7 at 62,377,738 bp
  • G to T, chromosome 7 at 75,611,434 bp
  • G to A, chromosome 7 at 78,477,935 bp
  • C to A, chromosome 7 at 82,578,594 bp
  • T to C, chromosome 7 at 118,794,575 bp
  • T to A, chromosome 7 at 119,967,759 bp
  • T to A, chromosome 7 at 130,621,857 bp
  • T to A, chromosome 7 at 135,704,241 bp
  • A to T, chromosome 8 at 25,164,493 bp
  • A to T, chromosome 8 at 72,386,868 bp
  • C to A, chromosome 8 at 94,779,573 bp
  • C to T, chromosome 8 at 111,628,537 bp
  • G to A, chromosome 8 at 124,605,711 bp
  • C to T, chromosome 9 at 22,358,604 bp
  • T to G, chromosome 9 at 27,083,346 bp
  • A to T, chromosome 9 at 86,372,487 bp
  • A to G, chromosome 9 at 119,432,808 bp
  • T to A, chromosome 10 at 40,934,468 bp
  • T to A, chromosome 10 at 81,278,054 bp
  • T to G, chromosome 10 at 127,011,892 bp
  • T to C, chromosome 10 at 129,251,074 bp
  • T to C, chromosome 11 at 46,286,131 bp
  • A to T, chromosome 11 at 53,979,733 bp
  • A to T, chromosome 11 at 59,454,955 bp
  • CAAATAAATAAATAAATAAATAAATAAATAAATAAA to CAAATAAATAAATAAATAAATAAATAAATAAATAAATAAA, chromosome 11 at 68,829,866 bp
  • G to C, chromosome 11 at 76,211,050 bp
  • A to T, chromosome 11 at 78,475,307 bp
  • G to A, chromosome 11 at 78,540,034 bp
  • A to T, chromosome 11 at 87,583,436 bp
  • T to A, chromosome 11 at 101,566,191 bp
  • A to T, chromosome 11 at 117,773,525 bp
  • T to A, chromosome 12 at 101,146,760 bp
  • A to G, chromosome 13 at 60,729,531 bp
  • T to A, chromosome 13 at 60,761,667 bp
  • T to A, chromosome 13 at 63,210,149 bp
  • A to T, chromosome 13 at 76,091,812 bp
  • A to G, chromosome 14 at 27,476,614 bp
  • T to A, chromosome 14 at 31,258,331 bp
  • T to C, chromosome 14 at 56,082,283 bp
  • A to T, chromosome 14 at 66,727,532 bp
  • A to G, chromosome 14 at 73,517,996 bp
  • A to T, chromosome 14 at 101,900,238 bp
  • A to T, chromosome 14 at 121,302,211 bp
  • A to T, chromosome 15 at 76,715,581 bp
  • T to A, chromosome 15 at 85,963,223 bp
  • T to C, chromosome 15 at 99,933,676 bp
  • T to A, chromosome 16 at 4,991,779 bp
  • A to T, chromosome 16 at 11,150,605 bp
  • A to T, chromosome 16 at 17,280,811 bp
  • A to G, chromosome 16 at 22,841,989 bp
  • G to C, chromosome 16 at 26,371,550 bp
  • T to A, chromosome 17 at 14,928,332 bp
  • C to A, chromosome 18 at 34,312,045 bp
  • C to A, chromosome 18 at 37,447,870 bp
  • T to C, chromosome 19 at 3,622,708 bp
  • T to C, chromosome 19 at 4,602,551 bp
  • T to C, chromosome 19 at 11,690,950 bp
  • A to G, chromosome 19 at 43,854,311 bp
  • T to G, chromosome 19 at 53,926,326 bp
  • T to C, chromosome Y at 941,483 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2131 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
040134-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.