Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2131Btlr/Mmmh
Stock Number:
040134-MU
Citation ID:
RRID:MMRRC_040134-MU
Other Names:
R2131 (G1), C57BL/6J-MtgxR2131Btlr
Major Collection:

Strain Information

Septin4
Name: septin 4
Synonyms: cell division control-related protein 2b, Pnutl2, Bh5, septin H5, Gm11492, ARTS, Sept4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18952
HGNC: HGNC:9165
Homologene: 6107
Ntrk3
Name: neurotrophic tyrosine kinase, receptor, type 3
Synonyms: TrkC
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18213
HGNC: HGNC:8033
Homologene: 49183
Eya1
Name: EYA transcriptional coactivator and phosphatase 1
Synonyms: bor
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14048
HGNC: HGNC:3519
Homologene: 74943
Sort1
Name: sortilin 1
Synonyms: sortilin, neurotensin receptor 3, Ntsr3, Ntr3, 2900053A11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20661
Homologene: 136097
Pzp2
Name: PZP alpha-2-macroglobulin like 2
Synonyms: Pzp
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11287
Homologene: 104112
Il4i1
Name: interleukin 4 induced 1
Synonyms: Fig1-ps, Fig1, H46, H4, H-46, H-4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14204
Homologene: 22567
Gli2
Name: GLI-Kruppel family member GLI2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14633
HGNC: HGNC:4318
Homologene: 12725
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 14,170,974 bp
  • T to C, chromosome 1 at 26,685,854 bp
  • T to C, chromosome 1 at 39,624,978 bp
  • T to G, chromosome 1 at 40,607,741 bp
  • A to G, chromosome 1 at 58,169,843 bp
  • A to G, chromosome 1 at 87,386,534 bp
  • A to T, chromosome 1 at 118,964,444 bp
  • C to A, chromosome 1 at 133,279,365 bp
  • C to G, chromosome 1 at 133,350,778 bp
  • A to T, chromosome 1 at 133,903,796 bp
  • C to T, chromosome 1 at 133,915,131 bp
  • ACTCTCTCT to ACTCTCTCTCT, chromosome 1 at 134,746,741 bp
  • ATCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTCCTC, chromosome 1 at 135,386,268 bp
  • A to G, chromosome 1 at 135,402,250 bp
  • TG to TGG, chromosome 1 at 135,846,761 bp
  • AGGG to AGG, chromosome 1 at 135,974,852 bp
  • CC to CCGAC, chromosome 1 at 136,490,395 bp
  • T to G, chromosome 1 at 139,831,155 bp
  • T to C, chromosome 1 at 143,760,034 bp
  • A to G, chromosome 1 at 156,065,349 bp
  • G to A, chromosome 1 at 194,644,750 bp
  • T to A, chromosome 2 at 11,783,695 bp
  • T to A, chromosome 2 at 18,733,097 bp
  • C to A, chromosome 2 at 27,299,396 bp
  • A to G, chromosome 2 at 36,480,047 bp
  • T to A, chromosome 2 at 49,758,805 bp
  • T to A, chromosome 2 at 76,586,214 bp
  • A to T, chromosome 2 at 76,647,136 bp
  • A to T, chromosome 2 at 76,832,217 bp
  • T to A, chromosome 2 at 83,879,858 bp
  • T to C, chromosome 2 at 103,981,062 bp
  • T to A, chromosome 2 at 135,325,667 bp
  • A to T, chromosome 2 at 156,095,510 bp
  • T to C, chromosome 2 at 158,000,743 bp
  • T to A, chromosome 2 at 163,547,418 bp
  • T to A, chromosome 2 at 180,992,573 bp
  • G to T, chromosome 3 at 45,432,466 bp
  • A to T, chromosome 3 at 75,908,149 bp
  • G to A, chromosome 3 at 87,810,572 bp
  • C to A, chromosome 3 at 89,142,660 bp
  • A to G, chromosome 3 at 95,989,117 bp
  • G to T, chromosome 3 at 103,094,878 bp
  • T to A, chromosome 3 at 103,735,869 bp
  • T to A, chromosome 3 at 108,351,686 bp
  • T to A, chromosome 3 at 116,539,124 bp
  • T to C, chromosome 3 at 118,674,568 bp
  • T to C, chromosome 3 at 134,932,180 bp
  • T to C, chromosome 3 at 148,890,488 bp
  • T to A, chromosome 4 at 43,370,726 bp
  • GCCC to GCCCCCCC, chromosome 4 at 53,563,246 bp
  • T to A, chromosome 4 at 104,784,394 bp
  • A to C, chromosome 4 at 109,665,063 bp
  • T to C, chromosome 4 at 126,559,909 bp
  • TTCCTCCTCCTCCTCCTCCTC to TTCCTCCTCCTCCTCCTC, chromosome 4 at 154,036,306 bp
  • C to T, chromosome 4 at 155,655,238 bp
  • T to A, chromosome 5 at 29,474,189 bp
  • T to A, chromosome 5 at 31,058,072 bp
  • T to A, chromosome 5 at 32,990,781 bp
  • A to G, chromosome 5 at 34,877,109 bp
  • T to C, chromosome 5 at 62,677,958 bp
  • G to T, chromosome 5 at 71,641,224 bp
  • T to A, chromosome 5 at 72,696,579 bp
  • T to C, chromosome 5 at 105,274,744 bp
  • A to G, chromosome 5 at 108,428,203 bp
  • G to A, chromosome 5 at 121,172,026 bp
  • T to A, chromosome 5 at 122,438,250 bp
  • G to A, chromosome 5 at 134,136,153 bp
  • A to C, chromosome 5 at 137,733,681 bp
  • C to T, chromosome 5 at 144,174,988 bp
  • T to A, chromosome 5 at 144,208,645 bp
  • A to G, chromosome 5 at 150,557,129 bp
  • T to C, chromosome 5 at 151,045,168 bp
  • C to T, chromosome 6 at 30,745,885 bp
  • A to C, chromosome 6 at 48,442,661 bp
  • T to C, chromosome 6 at 128,491,161 bp
  • T to A, chromosome 6 at 128,576,260 bp
  • A to G, chromosome 6 at 130,335,775 bp
  • T to C, chromosome 6 at 134,870,442 bp
  • A to T, chromosome 7 at 7,284,285 bp
  • A to T, chromosome 7 at 26,820,710 bp
  • T to A, chromosome 7 at 27,654,349 bp
  • G to A, chromosome 7 at 44,840,070 bp
  • A to T, chromosome 7 at 46,250,100 bp
  • T to A, chromosome 7 at 48,824,644 bp
  • A to T, chromosome 7 at 62,377,738 bp
  • G to T, chromosome 7 at 75,611,434 bp
  • G to A, chromosome 7 at 78,477,935 bp
  • C to A, chromosome 7 at 82,578,594 bp
  • T to C, chromosome 7 at 118,794,575 bp
  • T to A, chromosome 7 at 119,967,759 bp
  • T to A, chromosome 7 at 130,621,857 bp
  • T to A, chromosome 7 at 135,704,241 bp
  • A to T, chromosome 8 at 25,164,493 bp
  • A to T, chromosome 8 at 72,386,868 bp
  • C to A, chromosome 8 at 94,779,573 bp
  • C to T, chromosome 8 at 111,628,537 bp
  • G to A, chromosome 8 at 124,605,711 bp
  • C to T, chromosome 9 at 22,358,604 bp
  • T to G, chromosome 9 at 27,083,346 bp
  • A to T, chromosome 9 at 86,372,487 bp
  • A to G, chromosome 9 at 119,432,808 bp
  • T to A, chromosome 10 at 40,934,468 bp
  • T to A, chromosome 10 at 81,278,054 bp
  • T to G, chromosome 10 at 127,011,892 bp
  • T to C, chromosome 10 at 129,251,074 bp
  • T to C, chromosome 11 at 46,286,131 bp
  • A to T, chromosome 11 at 53,979,733 bp
  • A to T, chromosome 11 at 59,454,955 bp
  • CAAATAAATAAATAAATAAATAAATAAATAAATAAA to CAAATAAATAAATAAATAAATAAATAAATAAATAAATAAA, chromosome 11 at 68,829,866 bp
  • G to C, chromosome 11 at 76,211,050 bp
  • A to T, chromosome 11 at 78,475,307 bp
  • G to A, chromosome 11 at 78,540,034 bp
  • A to T, chromosome 11 at 87,583,436 bp
  • T to A, chromosome 11 at 101,566,191 bp
  • A to T, chromosome 11 at 117,773,525 bp
  • T to A, chromosome 12 at 101,146,760 bp
  • A to G, chromosome 13 at 60,729,531 bp
  • T to A, chromosome 13 at 60,761,667 bp
  • T to A, chromosome 13 at 63,210,149 bp
  • A to T, chromosome 13 at 76,091,812 bp
  • A to G, chromosome 14 at 27,476,614 bp
  • T to A, chromosome 14 at 31,258,331 bp
  • T to C, chromosome 14 at 56,082,283 bp
  • A to T, chromosome 14 at 66,727,532 bp
  • A to G, chromosome 14 at 73,517,996 bp
  • A to T, chromosome 14 at 101,900,238 bp
  • A to T, chromosome 14 at 121,302,211 bp
  • A to T, chromosome 15 at 76,715,581 bp
  • T to A, chromosome 15 at 85,963,223 bp
  • T to C, chromosome 15 at 99,933,676 bp
  • T to A, chromosome 16 at 4,991,779 bp
  • A to T, chromosome 16 at 11,150,605 bp
  • A to T, chromosome 16 at 17,280,811 bp
  • A to G, chromosome 16 at 22,841,989 bp
  • G to C, chromosome 16 at 26,371,550 bp
  • T to A, chromosome 17 at 14,928,332 bp
  • C to A, chromosome 18 at 34,312,045 bp
  • C to A, chromosome 18 at 37,447,870 bp
  • T to C, chromosome 19 at 3,622,708 bp
  • T to C, chromosome 19 at 4,602,551 bp
  • T to C, chromosome 19 at 11,690,950 bp
  • A to G, chromosome 19 at 43,854,311 bp
  • T to G, chromosome 19 at 53,926,326 bp
  • T to C, chromosome Y at 941,483 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2131 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040134-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.