Strain Name:
C57BL/6J-MtgxR2133Btlr/Mmmh
Stock Number:
040136-MU
Citation ID:
RRID:MMRRC_040136-MU
Other Names:
R2133 (G1), C57BL/6J-MtgxR2133Btlr
Major Collection:

Gene Information

Cntnap2
Name: contactin associated protein-like 2
Synonyms: 5430425M22Rik, Caspr2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 66797
Homologene: 69159
Septin4
Name: septin 4
Synonyms: Pnutl2, Sept4, ARTS, septin H5, Bh5, cell division control-related protein 2b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 18952
HGNC: HGNC:9165
Homologene: 6107
Ntrk3
Name: neurotrophic tyrosine kinase, receptor, type 3
Synonyms: TrkC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18213
HGNC: HGNC:8033
Homologene: 49183
Cacna1h
Name: calcium channel, voltage-dependent, T type, alpha 1H subunit
Synonyms: T-type Cav3.2, alpha13.2, Cav3.2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 58226
HGNC: HGNC:1395
Homologene: 56913
Sort1
Name: sortilin 1
Synonyms: Ntr3, Ntsr3, neurotensin receptor 3, 2900053A11Rik, sortilin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 20661
Homologene: 136097
Emx2
Name: empty spiracles homeobox 2
Synonyms: Pdo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 13797
HGNC: HGNC:3341
Homologene: 3023
Epb41l4a
Name: erythrocyte membrane protein band 4.1 like 4a
Synonyms: NBL4, Epb4.1l4a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 13824
VEGA: 18
Homologene: 8398
Spidr
Name: scaffolding protein involved in DNA repair
Synonyms: 2310008H04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 224008
VEGA: 16
Homologene: 51693
Etv4
Name: ets variant 4
Synonyms: Pea-3, Pea3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 18612
HGNC: HGNC:3493
Homologene: 1504
Ddx10
Name: DEAD box helicase 10
Synonyms: 4632415A01Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 77591
VEGA: 9
HGNC: HGNC:2735
Homologene: 20922
Msra
Name: methionine sulfoxide reductase A
Synonyms: 6530413P12Rik, MSR-A, 2310045J23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 110265
HGNC: HGNC:7377
Homologene: 5812
Vps35l
Name: VPS35 endosomal protein sorting factor like
Synonyms: Vsp35l, 9030624J02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 71517
Homologene: 10659
Rc3h2
Name: ring finger and CCCH-type zinc finger domains 2
Synonyms: Rnf164, D930043C02Rik, 2900024N03Rik, 9430019J22Rik, Mnab
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 319817
Homologene: 28276
Anln
Name: anillin, actin binding protein
Synonyms: 2900037I21Rik, 1110037A17Rik, Scraps
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 68743
VEGA: 9
Homologene: 41281
Exoc4
Name: exocyst complex component 4
Synonyms: Sec8l1, Sec8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 20336
Homologene: 40654
Ptprg
Name: protein tyrosine phosphatase, receptor type, G
Synonyms: 5430405N12Rik, RPTPgamma
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 19270
HGNC: HGNC:9671
Homologene: 2129
Zfp280d
Name: zinc finger protein 280D
Synonyms: Suhw4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235469
Homologene: 17151
Helz
Name: helicase with zinc finger domain
Synonyms: 3110078M01Rik, 9630002H22Rik, 9430093I07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 78455
Homologene: 8918
Faf1
Name: Fas-associated factor 1
Synonyms: Fam, Dffrx
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 14084
HGNC: HGNC:3578
Homologene: 5120
Trappc12
Name: trafficking protein particle complex 12
Synonyms: D930014A20Rik, Ttc15, CGI-87
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217449
VEGA: 12
Homologene: 34805
Akap13
Name: A kinase (PRKA) anchor protein 13
Synonyms: PROTO-LBC, 1700026G02Rik, 5730522G15Rik, 5830460E08Rik, PROTO-LB, Ht31, AKAP-Lbc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 75547
HGNC: HGNC:371
Homologene: 4903
Zfp64
Name: zinc finger protein 64
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22722
Homologene: 7604
Lmtk2
Name: lemur tyrosine kinase 2
Synonyms: BREK, KPI-2, cprk, KPI2, AATYK2, A330101P12Rik, 2900041G10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231876
Homologene: 8948
Mki67
Name: antigen identified by monoclonal antibody Ki 67
Synonyms: Ki-67, D630048A14Rik, Ki67
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 17345
HGNC: HGNC:7107
Homologene: 1814
Tasor
Name: transcription activation suppressor
Synonyms: 4933409E02Rik, D14Abb1e, Fam208a, MommeD6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 218850
VEGA: 14
Homologene: 9062
Fkbp15
Name: FK506 binding protein 15
Synonyms: FKBP133, C430014M02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 338355
Homologene: 28743
Myo9b
Name: myosin IXb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 17925
HGNC: HGNC:7609
Homologene: 3058
Senp1
Name: SUMO1/sentrin specific peptidase 1
Synonyms: E330036L07Rik, D15Ertd528e, 2310046A20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223870
Homologene: 8731
Dis3
Name: DIS3 homolog, exosome endoribonuclease and 3'-5' exoribonuclease
Synonyms: 2810028N01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 72662
VEGA: 14
Homologene: 6910
Tacc1
Name: transforming, acidic coiled-coil containing protein 1
Synonyms: B230378H13Rik, 4833447E04Rik, Tacc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 320165
Homologene: 4575
Ccdc141
Name: coiled-coil domain containing 141
Synonyms: 2610301F02Rik, ENSMUSG00000075261, CAMDI
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 545428
Homologene: 52149
Ipo9
Name: importin 9
Synonyms: 0710008K06Rik, Imp9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226432
Homologene: 5874
Eps15l1
Name: epidermal growth factor receptor pathway substrate 15-like 1
Synonyms: 9830147J04Rik, Eps15R, Eps15-rs
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 13859
Homologene: 31881
Zdhhc13
Name: zinc finger, DHHC domain containing 13
Synonyms: 2410004E01Rik, Hip14l, skc4, kojak
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 243983
Homologene: 75106
Slc41a3
Name: solute carrier family 41, member 3
Synonyms: 1010001P06Rik, SLC41A1-L2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 71699
Homologene: 23052
Ndel1
Name: nudE neurodevelopment protein 1 like 1
Synonyms: 2600006O07Rik, mNudel
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 83431
Homologene: 32567
Etv6
Name: ets variant 6
Synonyms: Tel, translocation-ets-leukemia
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 14011
HGNC: HGNC:3495
Homologene: 37560
Zswim6
Name: zinc finger SWIM-type containing 6
Synonyms: 2900036G02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 67263
VEGA: 13
Homologene: 83517
Rfwd3
Name: ring finger and WD repeat domain 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234736
Homologene: 41230
Ror1
Name: receptor tyrosine kinase-like orphan receptor 1
Synonyms: Ntrkr1, 2810404D04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 26563
Homologene: 3675
Syt17
Name: synaptotagmin XVII
Synonyms: Bk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 110058
Homologene: 9553
Syt2
Name: synaptotagmin II
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20980
Homologene: 22516
Magel2
Name: melanoma antigen, family L, 2
Synonyms: nM15, Mage-l2, ns7, NDNL1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 27385
HGNC: HGNC:6814
Homologene: 8460
Apc
Name: APC, WNT signaling pathway regulator
Synonyms: adenomatosis polyposis coli, Min, CC1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 11789
HGNC: HGNC:583
Homologene: 30950
Inpp5b
Name: inositol polyphosphate-5-phosphatase B
Synonyms: 75kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 16330
HGNC: HGNC:6077
Homologene: 69021
Khsrp
Name: KH-type splicing regulatory protein
Synonyms: 6330409F21Rik, KSRP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 16549
VEGA: 17
HGNC: HGNC:6316
Homologene: 2734
Cars
Name: cysteinyl-tRNA synthetase
Synonyms: CA3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 27267
HGNC: HGNC:1493
Homologene: 1328
Morc2a
Name: microrchidia 2A
Synonyms: 8430403M08Rik, Zcwcc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 74522
Homologene: 8966
Zfyve26
Name: zinc finger, FYVE domain containing 26
Synonyms: LOC380767, 9330197E15Rik, A630028O16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 211978
VEGA: 12
Homologene: 9102
Zfp236
Name: zinc finger protein 236
Synonyms: LOC240456
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 329002
Homologene: 7198
Pard6g
Name: par-6 family cell polarity regulator gamma
Synonyms: 2410049N21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93737
VEGA: 18
Homologene: 36487
Gemin4
Name: gem nuclear organelle associated protein 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 276919
Homologene: 69193
Slc9a4
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 4
Synonyms: D730009J23Rik, NHE4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 110895
Homologene: 72232
Lmo2
Name: LIM domain only 2
Synonyms: Rbtn-2, Rhom-2, Rbtn2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 16909
HGNC: HGNC:6642
Homologene: 4072
Ube2t
Name: ubiquitin-conjugating enzyme E2T
Synonyms: 2700084L22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67196
Homologene: 40929
Avil
Name: advillin
Synonyms: DOC6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 11567
Homologene: 38200
Atp6v1c2
Name: ATPase, H+ transporting, lysosomal V1 subunit C2
Synonyms: 1110038G14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 68775
Homologene: 15866
Fgf17
Name: fibroblast growth factor 17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 14171
VEGA: 14
HGNC: HGNC:3673
Homologene: 2872
Cep164
Name: centrosomal protein 164
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 214552
Homologene: 51110
Rnf157
Name: ring finger protein 157
Synonyms: A130073L17Rik, 2610036E23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217340
Homologene: 28235
Ttn
Name: titin
Synonyms: 2310036G12Rik, mdm, 1100001C23Rik, shru, D830007G01Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, L56, connectin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Acacb
Name: acetyl-Coenzyme A carboxylase beta
Synonyms: Accb, Acc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100705
HGNC: HGNC:85
Homologene: 74382
Gm1965
Name: predicted gene 1965
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 434065
AC159748.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Pkhd1l1
Name: polycystic kidney and hepatic disease 1-like 1
Synonyms: D86 mRNA, PKHDL1, fibrocystin L
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 192190
Homologene: 16332
Insrr
Name: insulin receptor-related receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 23920
HGNC: HGNC:6093
Homologene: 56539
Fhad1
Name: forkhead-associated (FHA) phosphopeptide binding domain 1
Synonyms: 2900090M10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 329977
Homologene: 77947
Kif5c
Name: kinesin family member 5C
Synonyms: Khc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 16574
HGNC: HGNC:6325
Homologene: 56234
Atp7b
Name: ATPase, Cu++ transporting, beta polypeptide
Synonyms: Atp7a, Wilson protein, WND
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 11979
HGNC: HGNC:870
Homologene: 20063
Plcb1
Name: phospholipase C, beta 1
Synonyms: 3110043I21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18795
Homologene: 22876
Dbt
Name: dihydrolipoamide branched chain transacylase E2
Synonyms: dihydrolipoyllysine-residue (2-methylpropanoyl)transferase, D3Wsu60e, BCKAD E2, dihydrolipoyl transacylase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 13171
HGNC: HGNC:2698
Homologene: 1444
Tdrd6
Name: tudor domain containing 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 210510
Homologene: 19364
Abcb11
Name: ATP-binding cassette, sub-family B (MDR/TAP), member 11
Synonyms: ABC16, sister of P-glycoprotein, Lith1, Bsep, PGY4, PFIC2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 27413
HGNC: HGNC:42
Homologene: 74509
Irak3
Name: interleukin-1 receptor-associated kinase 3
Synonyms: 4833428C18Rik, IRAK-M
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 73914
Homologene: 36215
Olfr1245
Name: olfactory receptor 1245
Synonyms: MOR231-12, GA_x6K02T2Q125-51020951-51020028
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258784
Homologene: 121560
Ogdhl
Name: oxoglutarate dehydrogenase-like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 239017
VEGA: 14
Homologene: 56801
Nrp1
Name: neuropilin 1
Synonyms: NPN-1, Neuropilin-1, Npn1, NP-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 18186
HGNC: HGNC:8004
Homologene: 2876
Clstn3
Name: calsyntenin 3
Synonyms: alcadein-beta, Cst-3, CSTN3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232370
Homologene: 22836
Myh3
Name: myosin, heavy polypeptide 3, skeletal muscle, embryonic
Synonyms: Myhs-e, Myhse, MyHC-emb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17883
HGNC: HGNC:7573
Homologene: 20553
BC034090
Name: cDNA sequence BC034090
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 207792
Homologene: 19490
Ctse
Name: cathepsin E
Synonyms: CatE, C920004C08Rik, A430072O03Rik, CE
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13034
HGNC: HGNC:2530
Homologene: 37551
Aox3
Name: aldehyde oxidase 3
Synonyms: 1200011D03Rik, AOH1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 71724
Homologene: 90899
Osbpl6
Name: oxysterol binding protein-like 6
Synonyms: ORP-6, 1110062M20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 99031
Homologene: 101447
Myo15b
Name: myosin XVB
Synonyms: E330039G21Rik, LOC380737, LOC217328
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217328
Dmrta1
Name: doublesex and mab-3 related transcription factor like family A1
Synonyms: Dmrt4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242523
Homologene: 18477
Plekha6
Name: pleckstrin homology domain containing, family A member 6
Synonyms: Pepp3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240753
Homologene: 135779
Zfp541
Name: zinc finger protein 541
Synonyms: EG666528
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 666528
Homologene: 12991
Kif14
Name: kinesin family member 14
Synonyms: N-3 kinesin, D1Ertd367e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 381293
Homologene: 8916
Zfp521
Name: zinc finger protein 521
Synonyms: B930086A16Rik, Evi3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 225207
VEGA: 18
Homologene: 9151
Tecpr1
Name: tectonin beta-propeller repeat containing 1
Synonyms: 2210010N04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 70381
Homologene: 9120
Mcrs1
Name: microspherule protein 1
Synonyms: P78, C78274, MSP58, ICP22BP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 51812
VEGA: 15
HGNC: HGNC:6960
Homologene: 4622
Olfml3
Name: olfactomedin-like 3
Synonyms: mONT3, HNOEL-iso, 2810002E22Rik, ONT3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 99543
Homologene: 10613
C2
Name: complement component 2 (within H-2S)
Synonyms: classical-complement pathway C3/C5 convertase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 12263
HGNC: HGNC:1248
Homologene: 45
Igfn1
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226438
Homologene: 130054
Pcdhb14
Name: protocadherin beta 14
Synonyms: Pcdhb17, 2210006M07Rik, PcdhbN
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93885
Homologene: 70876
Adgrb1
Name: adhesion G protein-coupled receptor B1
Synonyms: Bai1, B830018M07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 107831
HGNC: HGNC:943
Homologene: 1287
Lgmn
Name: legumain
Synonyms: preprolegumain, Prsc1, AEP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 19141
HGNC: HGNC:9472
Homologene: 38075
Ren1
Name: renin 1 structural
Synonyms: Ren-1, Ren1c, Rn-1, Ren-A, Ren1d, Rnr, Ren
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 19701
HGNC: HGNC:9958
Homologene: 20151
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: ELK1, C130090D05Rik, Kv12.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 211468
Homologene: 14332
Rbm12
Name: RNA binding motif protein 12
Synonyms: SWAN, 5730420G12Rik, 9430070C08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 75710
HGNC: HGNC:9898
Homologene: 34993
Fam217a
Name: family with sequence similarity 217, member A
Synonyms: 1700026J04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 71864
VEGA: 13
Homologene: 82344
Zc3h6
Name: zinc finger CCCH type containing 6
Synonyms: 4631426G04Rik, 4833425H18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 78751
Homologene: 35328
Ro60
Name: Ro60, Y RNA binding protein
Synonyms: Ssa2, Trove2, 1810007I17Rik, Ssa, SS-A/Ro, A530054J02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20822
Homologene: 3383
Tmem14a
Name: transmembrane protein 14A
Synonyms: 5730496E24Rik, PTD011
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 75712
Homologene: 36341
Larp1b
Name: La ribonucleoprotein domain family, member 1B
Synonyms: 4933421B21Rik, 1700108L22Rik, Larp2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 214048
Homologene: 103869
Rsph6a
Name: radial spoke head 6 homolog A (Chlamydomonas)
Synonyms: RSP4, Rshl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 83434
Homologene: 36476
Synpo
Name: synaptopodin
Synonyms: 9030217H17Rik, 9330140I15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 104027
Homologene: 5274
1700067P10Rik
Name: RIKEN cDNA 1700067P10 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 68224
VEGA: 17
Homologene: 87035
Mpp2
Name: membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)
Synonyms: D11Bwg0652e, Pals4, Dlg2, Dlgh2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 50997
HGNC: HGNC:7220
Homologene: 3920
Stard13
Name: StAR-related lipid transfer (START) domain containing 13
Synonyms: DLC2, GT650
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 243362
Homologene: 64844
Tmem132a
Name: transmembrane protein 132A
Synonyms: 6720481D13Rik, Hspa5bp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 98170
Homologene: 75076
Sox13
Name: SRY (sex determining region Y)-box 13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20668
Homologene: 4159
Tjp3
Name: tight junction protein 3
Synonyms: ZO-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 27375
VEGA: 10
Homologene: 8458
Ugt2b34
Name: UDP glucuronosyltransferase 2 family, polypeptide B34
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100727
Homologene: 117389
Atp13a2
Name: ATPase type 13A2
Synonyms: 1110012E06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 74772
Homologene: 56940
Ttll1
Name: tubulin tyrosine ligase-like 1
Synonyms: 6330444E16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 319953
HGNC: HGNC:1312
Homologene: 8174
Trabd2b
Name: TraB domain containing 2B
Synonyms: Hkat, Gm12824
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 666048
Homologene: 85034
Eif3i
Name: eukaryotic translation initiation factor 3, subunit I
Synonyms: TRIP-1, D4Ertd632e, Eif3s2, 36kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 54709
HGNC: HGNC:3272
Homologene: 2786
Cyp2d34
Name: cytochrome P450, family 2, subfamily d, polypeptide 34
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223706
VEGA: 15
Homologene: 86099
Castor2
Name: cytosolic arginine sensor for mTORC1 subunit 2
Synonyms: Gatsl2, Gats
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 80909
Homologene: 84866
Tnnt2
Name: troponin T2, cardiac
Synonyms: cardiac TnT, cTnT, Tnt
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 21956
Homologene: 68050
Optc
Name: opticin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 269120
HGNC: HGNC:8158
Homologene: 8652
Gtpbp2
Name: GTP binding protein 2
Synonyms: nmf205
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 56055
HGNC: HGNC:4670
Homologene: 10420
Prelp
Name: proline arginine-rich end leucine-rich repeat
Synonyms: SLRR2A, 7330409J17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 116847
HGNC: HGNC:9357
Homologene: 2041
Olfr341
Name: olfactory receptor 341
Synonyms: MOR136-2, GA_x6K02T2NLDC-33174915-33173974
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258952
Homologene: 74160
Cyp4a14
Name: cytochrome P450, family 4, subfamily a, polypeptide 14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 13119
Homologene: 134697
Lpo
Name: lactoperoxidase
Synonyms: 5830499B15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 76113
HGNC: HGNC:6678
Homologene: 21240
Olfr453
Name: olfactory receptor 453
Synonyms: MOR257-8P, GA_x6K02T2P3E9-4815856-4814903
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 258016
HGNC: HGNC:8246
Homologene: 128151
Slc7a9
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 9
Synonyms: bo, +AT, bo, + amino acid transporter, CSNU3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 30962
Homologene: 56668
Golim4
Name: golgi integral membrane protein 4
Synonyms: GPP130, 3110027H23Rik, Golph4, P138
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 73124
Homologene: 8716
Epm2a
Name: epilepsy, progressive myoclonic epilepsy, type 2 gene alpha
Synonyms: Tg(TcraK,TcrbK)TG-BFlv, laforin, TG-B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 13853
HGNC: HGNC:3413
Homologene: 38087
Gpr132
Name: G protein-coupled receptor 132
Synonyms: G2 accumulation, G2a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 56696
VEGA: 12
Homologene: 8350
Camk2b
Name: calcium/calmodulin-dependent protein kinase II, beta
Synonyms: CaMK II
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 12323
HGNC: HGNC:1461
Homologene: 111050
Kiss1
Name: KiSS-1 metastasis-suppressor
Synonyms: metastin, kisspeptin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 280287
HGNC: HGNC:6341
Homologene: 1701
Ift20
Name: intraflagellar transport 20
Synonyms: 0610009H04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 55978
Homologene: 49559
Gm1587
Name: predicted gene 1587
Synonyms: LOC380920
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 380920
VEGA: 14
Ldhc
Name: lactate dehydrogenase C
Synonyms: Ldh3, Ldh-3, Ldhc4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16833
HGNC: HGNC:6544
Homologene: 22767
Ttc9b
Name: tetratricopeptide repeat domain 9B
Synonyms: 2900074C18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 73032
Homologene: 19938
Guca2b
Name: guanylate cyclase activator 2b (retina)
Synonyms: Gcap2, uroguanylin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 14916
HGNC: HGNC:4683
Homologene: 5150
Rrp1
Name: ribosomal RNA processing 1 homolog (S. cerevisiae)
Synonyms: NNP-1, Nnp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 18114
VEGA: 10
Mamld1
Name: mastermind-like domain containing 1
Synonyms: G630014P10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 333639
HGNC: HGNC:2568
Homologene: 135712
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 21,226,059 bp
  • T to G, chromosome 1 at 40,607,741 bp
  • A to G, chromosome 1 at 58,169,843 bp
  • ACTCTCTCTCTCTCTCT to ACTCTCTCTCTCTCTCTCT, chromosome 1 at 131,663,285 bp
  • C to A, chromosome 1 at 133,279,365 bp
  • AGTG to AGTGGCACCTTTGGTG, chromosome 1 at 133,327,321 bp
  • C to A, chromosome 1 at 133,358,982 bp
  • G to A, chromosome 1 at 133,387,071 bp
  • A to T, chromosome 1 at 133,903,796 bp
  • C to T, chromosome 1 at 133,915,131 bp
  • ACTCTCTCT to ACTCTCTCTCT, chromosome 1 at 134,746,741 bp
  • AG to AGG, chromosome 1 at 134,971,364 bp
  • ATCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTCCTC, chromosome 1 at 135,386,268 bp
  • TCC to TCCACC, chromosome 1 at 135,386,275 bp
  • A to G, chromosome 1 at 135,402,250 bp
  • TG to TGG, chromosome 1 at 135,846,761 bp
  • AGGG to AGG, chromosome 1 at 135,974,852 bp
  • CC to CCGAC, chromosome 1 at 136,490,395 bp
  • T to C, chromosome 1 at 143,760,034 bp
  • C to T, chromosome 1 at 155,225,786 bp
  • A to G, chromosome 2 at 36,480,047 bp
  • A to T, chromosome 2 at 37,378,916 bp
  • T to A, chromosome 2 at 49,758,805 bp
  • A to T, chromosome 2 at 69,323,883 bp
  • T to A, chromosome 2 at 76,586,214 bp
  • G to A, chromosome 2 at 76,850,612 bp
  • G to A, chromosome 2 at 77,059,607 bp
  • G to A, chromosome 2 at 89,575,256 bp
  • T to C, chromosome 2 at 103,981,062 bp
  • A to G, chromosome 2 at 128,967,830 bp
  • T to A, chromosome 2 at 135,325,667 bp
  • A to T, chromosome 2 at 156,095,510 bp
  • A to G, chromosome 2 at 168,940,743 bp
  • T to C, chromosome 3 at 40,970,535 bp
  • A to T, chromosome 3 at 75,908,149 bp
  • G to A, chromosome 3 at 87,810,572 bp
  • T to A, chromosome 3 at 103,735,869 bp
  • T to A, chromosome 3 at 108,351,686 bp
  • T to A, chromosome 3 at 116,539,124 bp
  • C to A, chromosome 4 at 62,327,899 bp
  • A to T, chromosome 4 at 89,688,709 bp
  • A to G, chromosome 4 at 100,410,025 bp
  • A to G, chromosome 4 at 109,710,845 bp
  • A to T, chromosome 4 at 114,610,008 bp
  • A to T, chromosome 4 at 115,491,391 bp
  • T to C, chromosome 4 at 119,657,631 bp
  • A to T, chromosome 4 at 124,785,168 bp
  • A to T, chromosome 4 at 129,596,926 bp
  • T to A, chromosome 4 at 141,005,016 bp
  • G to A, chromosome 4 at 141,928,400 bp
  • C to T, chromosome 5 at 86,906,557 bp
  • TGGGG to TGGG, chromosome 5 at 114,209,767 bp
  • G to A, chromosome 5 at 134,136,153 bp
  • C to T, chromosome 5 at 144,174,988 bp
  • T to A, chromosome 5 at 144,208,645 bp
  • T to C, chromosome 5 at 151,045,168 bp
  • T to C, chromosome 6 at 33,758,158 bp
  • T to C, chromosome 6 at 33,910,538 bp
  • C to A, chromosome 6 at 42,744,135 bp
  • T to C, chromosome 6 at 47,298,445 bp
  • A to G, chromosome 6 at 89,145,469 bp
  • C to T, chromosome 6 at 90,626,381 bp
  • T to C, chromosome 6 at 124,449,503 bp
  • T to C, chromosome 6 at 134,248,754 bp
  • T to A, chromosome 7 at 16,081,663 bp
  • T to A, chromosome 7 at 19,068,106 bp
  • T to A, chromosome 7 at 27,654,349 bp
  • T to C, chromosome 7 at 35,453,493 bp
  • A to T, chromosome 7 at 46,869,599 bp
  • T to A, chromosome 7 at 48,824,644 bp
  • A to T, chromosome 7 at 62,377,738 bp
  • G to T, chromosome 7 at 75,611,434 bp
  • G to A, chromosome 7 at 78,477,935 bp
  • C to T, chromosome 7 at 118,382,047 bp
  • T to C, chromosome 7 at 118,794,575 bp
  • T to A, chromosome 7 at 135,704,241 bp
  • C to A, chromosome 7 at 143,592,474 bp
  • T to C, chromosome 8 at 22,011,077 bp
  • A to T, chromosome 8 at 25,164,493 bp
  • C to A, chromosome 8 at 71,352,162 bp
  • A to T, chromosome 8 at 72,386,868 bp
  • A to T, chromosome 8 at 111,297,402 bp
  • A to T, chromosome 8 at 128,498,516 bp
  • C to T, chromosome 9 at 22,358,604 bp
  • T to C, chromosome 9 at 45,803,183 bp
  • T to A, chromosome 9 at 53,149,512 bp
  • T to C, chromosome 9 at 72,308,005 bp
  • G to A, chromosome 10 at 5,346,808 bp
  • A to G, chromosome 10 at 11,343,682 bp
  • T to C, chromosome 10 at 78,401,894 bp
  • T to A, chromosome 10 at 81,278,054 bp
  • A to G, chromosome 10 at 120,165,177 bp
  • T to G, chromosome 10 at 127,011,892 bp
  • T to A, chromosome 11 at 3,680,302 bp
  • T to C, chromosome 11 at 5,977,880 bp
  • T to A, chromosome 11 at 67,096,864 bp
  • CAAATAAATAAATAAATAAATAAATAAATAAATAAA to CAAATAAATAAATAAATAAATAAATAAATAAATAAATAAA, chromosome 11 at 68,829,866 bp
  • G to C, chromosome 11 at 76,211,050 bp
  • G to A, chromosome 11 at 78,540,034 bp
  • A to T, chromosome 11 at 87,583,436 bp
  • T to A, chromosome 11 at 87,821,130 bp
  • A to G, chromosome 11 at 101,775,417 bp
  • G to A, chromosome 11 at 102,064,595 bp
  • T to A, chromosome 11 at 107,670,484 bp
  • A to G, chromosome 11 at 115,881,791 bp
  • A to G, chromosome 11 at 116,358,694 bp
  • T to C, chromosome 12 at 17,321,611 bp
  • A to T, chromosome 12 at 28,746,598 bp
  • T to A, chromosome 12 at 79,268,434 bp
  • T to C, chromosome 12 at 102,394,908 bp
  • A to G, chromosome 12 at 112,852,403 bp
  • T to C, chromosome 13 at 34,913,680 bp
  • T to A, chromosome 13 at 107,743,987 bp
  • T to A, chromosome 14 at 12,211,637 bp
  • A to G, chromosome 14 at 27,476,614 bp
  • T to C, chromosome 14 at 32,325,934 bp
  • T to A, chromosome 14 at 64,233,928 bp
  • T to C, chromosome 14 at 70,638,487 bp
  • A to T, chromosome 14 at 77,794,856 bp
  • A to T, chromosome 14 at 99,079,877 bp
  • T to C, chromosome 15 at 44,516,185 bp
  • T to A, chromosome 15 at 74,529,908 bp
  • A to G, chromosome 15 at 82,618,501 bp
  • A to G, chromosome 15 at 83,505,235 bp
  • T to A, chromosome 15 at 98,075,967 bp
  • A to T, chromosome 15 at 99,243,375 bp
  • G to A, chromosome 16 at 16,053,273 bp
  • A to G, chromosome 17 at 25,383,528 bp
  • G to A, chromosome 17 at 34,879,902 bp
  • T to C, chromosome 17 at 43,624,833 bp
  • T to C, chromosome 17 at 46,161,202 bp
  • A to G, chromosome 17 at 48,090,452 bp
  • T to C, chromosome 17 at 52,893,933 bp
  • A to T, chromosome 17 at 57,027,832 bp
  • G to A, chromosome 18 at 13,844,705 bp
  • T to C, chromosome 18 at 33,874,195 bp
  • C to A, chromosome 18 at 34,312,045 bp
  • C to A, chromosome 18 at 37,447,870 bp
  • T to C, chromosome 18 at 60,602,895 bp
  • T to C, chromosome 18 at 80,117,308 bp
  • T to C, chromosome 18 at 82,621,304 bp
  • C to A, chromosome 19 at 10,864,066 bp
  • A to G, chromosome 19 at 59,464,033 bp
  • C to A, chromosome X at 71,119,392 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2133 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
040136-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.