Strain Name:
Stock Number:
Citation ID:
Other Names:
R2133 (G1), C57BL/6J-MtgxR2133Btlr
Major Collection:

Strain Information

Name: contactin associated protein-like 2
Synonyms: 5430425M22Rik, Caspr2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 66797
Homologene: 69159
Name: septin 4
Synonyms: cell division control-related protein 2b, Pnutl2, Bh5, septin H5, Gm11492, ARTS, Sept4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 18952
Homologene: 6107
Name: neurotrophic tyrosine kinase, receptor, type 3
Synonyms: TrkC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18213
Homologene: 49183
Name: calcium channel, voltage-dependent, T type, alpha 1H subunit
Synonyms: Cav3.2, alpha13.2, T-type Cav3.2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 58226
Homologene: 56913
Name: sortilin 1
Synonyms: sortilin, neurotensin receptor 3, Ntsr3, Ntr3, 2900053A11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 20661
Homologene: 136097
Name: empty spiracles homeobox 2
Synonyms: Pdo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 13797
Homologene: 3023
Name: erythrocyte membrane protein band 4.1 like 4a
Synonyms: NBL4, Epb4.1l4a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 13824
VEGA: 18
Homologene: 8398
Name: scaffolding protein involved in DNA repair
Synonyms: 2310008H04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 224008
VEGA: 16
Homologene: 51693
Name: ets variant 4
Synonyms: Pea-3, Pea3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 18612
Homologene: 1504
Name: DEAD box helicase 10
Synonyms: 4632415A01Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 77591
Homologene: 20922
Name: methionine sulfoxide reductase A
Synonyms: MSR-A, 2310045J23Rik, 6530413P12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 110265
Homologene: 5812
Name: VPS35 endosomal protein sorting factor like
Synonyms: 9030624J02Rik, Vsp35l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 71517
Homologene: 10659
Name: ring finger and CCCH-type zinc finger domains 2
Synonyms: Rnf164, D930043C02Rik, 2900024N03Rik, 9430019J22Rik, Mnab
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 319817
Homologene: 28276
Name: anillin, actin binding protein
Synonyms: 1110037A17Rik, Scraps, 2900037I21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 68743
Homologene: 41281
Name: exocyst complex component 4
Synonyms: Sec8, Sec8l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 20336
Homologene: 40654
Name: protein tyrosine phosphatase, receptor type, G
Synonyms: 5430405N12Rik, RPTPgamma
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 19270
Homologene: 2129
Name: zinc finger protein 280D
Synonyms: Suhw4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235469
Homologene: 17151
Name: helicase with zinc finger domain
Synonyms: 9630002H22Rik, 9430093I07Rik, 3110078M01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 78455
Homologene: 8918
Name: Fas-associated factor 1
Synonyms: Fam, Dffrx
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 14084
Homologene: 5120
Name: trafficking protein particle complex 12
Synonyms: CGI-87, D930014A20Rik, Ttc15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217449
VEGA: 12
Homologene: 34805
Name: A kinase (PRKA) anchor protein 13
Synonyms: AKAP-Lbc, PROTO-LBC, PROTO-LB, Ht31, 5730522G15Rik, 1700026G02Rik, 5830460E08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 75547
Homologene: 4903
Name: zinc finger protein 64
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22722
Homologene: 7604
Name: lemur tyrosine kinase 2
Synonyms: 2900041G10Rik, KPI-2, cprk, KPI2, A330101P12Rik, BREK, AATYK2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231876
Homologene: 8948
Name: antigen identified by monoclonal antibody Ki 67
Synonyms: Ki-67, D630048A14Rik, Ki67
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 17345
Homologene: 1814
Name: transcription activation suppressor
Synonyms: 4933409E02Rik, D14Abb1e, MommeD6, Fam208a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 218850
VEGA: 14
Homologene: 9062
Name: FK506 binding protein 15
Synonyms: FKBP133, C430014M02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 338355
Homologene: 28743
Name: myosin IXb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 17925
Homologene: 3058
Name: SUMO1/sentrin specific peptidase 1
Synonyms: 2310046A20Rik, E330036L07Rik, D15Ertd528e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223870
Homologene: 8731
Name: DIS3 homolog, exosome endoribonuclease and 3'-5' exoribonuclease
Synonyms: 2810028N01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 72662
VEGA: 14
Homologene: 6910
Name: transforming, acidic coiled-coil containing protein 1
Synonyms: 4833447E04Rik, Tacc1, B230378H13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 320165
Homologene: 4575
Name: coiled-coil domain containing 141
Synonyms: ENSMUSG00000075261, CAMDI, 2610301F02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 545428
Homologene: 52149
Name: importin 9
Synonyms: 0710008K06Rik, Imp9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226432
Homologene: 5874
Name: epidermal growth factor receptor pathway substrate 15-like 1
Synonyms: Eps15R, 9830147J04Rik, Eps15-rs
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 13859
Homologene: 31881
Name: zinc finger, DHHC domain containing 13
Synonyms: kojak, 2410004E01Rik, Hip14l, skc4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 243983
Homologene: 75106
Name: solute carrier family 41, member 3
Synonyms: SLC41A1-L2, 1010001P06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 71699
Homologene: 23052
Name: nudE neurodevelopment protein 1 like 1
Synonyms: 2600006O07Rik, mNudel
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 83431
Homologene: 32567
Name: ets variant 6
Synonyms: Tel, translocation-ets-leukemia
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 14011
Homologene: 37560
Name: zinc finger SWIM-type containing 6
Synonyms: 2900036G02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 67263
VEGA: 13
Homologene: 83517
Name: ring finger and WD repeat domain 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234736
Homologene: 41230
Name: receptor tyrosine kinase-like orphan receptor 1
Synonyms: Ntrkr1, 2810404D04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 26563
Homologene: 3675
Name: synaptotagmin XVII
Synonyms: Bk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 110058
Homologene: 9553
Name: synaptotagmin II
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20980
Homologene: 22516
Name: MAGE family member L2
Synonyms: NDNL1, Mage-l2, nM15, ns7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 27385
Homologene: 8460
Name: APC, WNT signaling pathway regulator
Synonyms: Min, CC1, adenomatosis polyposis coli
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 11789
Homologene: 30950
Name: inositol polyphosphate-5-phosphatase B
Synonyms: 75kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 16330
Homologene: 69021
Name: KH-type splicing regulatory protein
Synonyms: 6330409F21Rik, KSRP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 16549
VEGA: 17
Homologene: 2734
Name: cysteinyl-tRNA synthetase
Synonyms: CA3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 27267
Homologene: 1328
Name: microrchidia 2A
Synonyms: 8430403M08Rik, Zcwcc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 74522
Homologene: 8966
Name: zinc finger, FYVE domain containing 26
Synonyms: 9330197E15Rik, LOC380767, A630028O16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 211978
VEGA: 12
Homologene: 9102
Name: zinc finger protein 236
Synonyms: LOC240456
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 329002
Homologene: 7198
Name: par-6 family cell polarity regulator gamma
Synonyms: 2410049N21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93737
VEGA: 18
Homologene: 36487
Name: gem nuclear organelle associated protein 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 276919
Homologene: 69193
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 4
Synonyms: NHE4, D730009J23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 110895
Homologene: 72232
Name: LIM domain only 2
Synonyms: Rbtn-2, Rbtn2, Rhom-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 16909
Homologene: 4072
Name: ubiquitin-conjugating enzyme E2T
Synonyms: 2700084L22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67196
Homologene: 40929
Name: advillin
Synonyms: DOC6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 11567
Homologene: 38200
Name: ATPase, H+ transporting, lysosomal V1 subunit C2
Synonyms: 1110038G14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 68775
Homologene: 15866
Name: fibroblast growth factor 17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 14171
VEGA: 14
Homologene: 2872
Name: centrosomal protein 164
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 214552
Homologene: 51110
Name: ring finger protein 157
Synonyms: A130073L17Rik, 2610036E23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217340
Homologene: 28235
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Name: acetyl-Coenzyme A carboxylase beta
Synonyms: Accb, Acc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100705
Homologene: 74382
Name: predicted gene 1965
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 434065
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Name: polycystic kidney and hepatic disease 1-like 1
Synonyms: D86 mRNA, PKHDL1, fibrocystin L
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 192190
Homologene: 16332
Name: insulin receptor-related receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 23920
Homologene: 56539
Name: forkhead-associated (FHA) phosphopeptide binding domain 1
Synonyms: 2900090M10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 329977
Homologene: 77947
Name: kinesin family member 5C
Synonyms: Khc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 16574
Homologene: 56234
Name: ATPase, Cu++ transporting, beta polypeptide
Synonyms: WND, Wilson protein, Atp7a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 11979
Homologene: 20063
Name: phospholipase C, beta 1
Synonyms: 3110043I21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18795
Homologene: 22876
Name: dihydrolipoamide branched chain transacylase E2
Synonyms: BCKAD E2, D3Wsu60e, dihydrolipoyl transacylase, dihydrolipoyllysine-residue (2-methylpropanoyl)transferase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 13171
Homologene: 1444
Name: tudor domain containing 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 210510
Homologene: 19364
Name: ATP-binding cassette, sub-family B (MDR/TAP), member 11
Synonyms: PFIC2, ABC16, PGY4, Lith1, sister of P-glycoprotein, Bsep
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 27413
Homologene: 74509
Name: interleukin-1 receptor-associated kinase 3
Synonyms: IRAK-M, 4833428C18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 73914
Homologene: 36215
Name: olfactory receptor family 4 subfamily A member 72
Synonyms: GA_x6K02T2Q125-51020951-51020028, MOR231-12, Olfr1245
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258784
Homologene: 121560
Name: oxoglutarate dehydrogenase-like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 239017
VEGA: 14
Homologene: 56801
Name: neuropilin 1
Synonyms: Neuropilin-1, NP-1, NPN-1, Npn1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 18186
Homologene: 2876
Name: calsyntenin 3
Synonyms: Cst-3, CSTN3, alcadein-beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232370
Homologene: 22836
Name: myosin, heavy polypeptide 3, skeletal muscle, embryonic
Synonyms: MyHC-emb, Myhs-e, Myhse
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17883
Homologene: 20553
Name: cDNA sequence BC034090
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 207792
Homologene: 19490
Name: cathepsin E
Synonyms: CE, CatE, A430072O03Rik, C920004C08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13034
Homologene: 37551
Name: aldehyde oxidase 3
Synonyms: AOH1, 1200011D03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 71724
Homologene: 90899
Name: oxysterol binding protein-like 6
Synonyms: ORP-6, 1110062M20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 99031
Homologene: 101447
Name: myosin XVB
Synonyms: LOC217328, LOC380737, E330039G21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217328
Name: doublesex and mab-3 related transcription factor like family A1
Synonyms: Dmrt4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242523
Homologene: 18477
Name: pleckstrin homology domain containing, family A member 6
Synonyms: Pepp3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240753
Homologene: 135779
Name: zinc finger protein 541
Synonyms: EG666528
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 666528
Homologene: 12991
Name: kinesin family member 14
Synonyms: N-3 kinesin, D1Ertd367e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 381293
Homologene: 8916
Name: zinc finger protein 521
Synonyms: B930086A16Rik, Evi3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 225207
VEGA: 18
Homologene: 9151
Name: tectonin beta-propeller repeat containing 1
Synonyms: 2210010N04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 70381
Homologene: 9120
Name: microspherule protein 1
Synonyms: P78, ICP22BP, MSP58, C78274
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 51812
VEGA: 15
Homologene: 4622
Name: olfactomedin-like 3
Synonyms: HNOEL-iso, 2810002E22Rik, mONT3, ONT3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 99543
Homologene: 10613
Name: complement component 2 (within H-2S)
Synonyms: classical-complement pathway C3/C5 convertase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 12263
Homologene: 45
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226438
Homologene: 130054
Name: protocadherin beta 14
Synonyms: Pcdhb17, PcdhbN, 2210006M07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93885
Homologene: 70876
Name: adhesion G protein-coupled receptor B1
Synonyms: B830018M07Rik, Bai1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 107831
Homologene: 1287
Name: legumain
Synonyms: preprolegumain, Prsc1, AEP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 19141
Homologene: 38075
Name: renin 1 structural
Synonyms: Ren1d, Ren-A, Rn-1, Ren, Rnr, Ren-1, Ren1c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 19701
Homologene: 20151
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 211468
Homologene: 14332
Name: RNA binding motif protein 12
Synonyms: 5730420G12Rik, SWAN, 9430070C08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 75710
Homologene: 34993
Name: family with sequence similarity 217, member A
Synonyms: 1700026J04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 71864
VEGA: 13
Homologene: 82344
Name: zinc finger CCCH type containing 6
Synonyms: 4631426G04Rik, 4833425H18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 78751
Homologene: 35328
Name: Ro60, Y RNA binding protein
Synonyms: SS-A/Ro, Ssa, A530054J02Rik, 1810007I17Rik, Ssa2, Trove2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20822
Homologene: 3383
Name: transmembrane protein 14A
Synonyms: PTD011, 5730496E24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 75712
Homologene: 36341
Name: La ribonucleoprotein 1B
Synonyms: 1700108L22Rik, 4933421B21Rik, Larp2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 214048
Homologene: 103869
Name: radial spoke head 6 homolog A (Chlamydomonas)
Synonyms: RSP4, Rshl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 83434
Homologene: 36476
Name: synaptopodin
Synonyms: 9330140I15Rik, 9030217H17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 104027
Homologene: 5274
Name: RIKEN cDNA 1700067P10 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 68224
VEGA: 17
Homologene: 87035
Name: membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)
Synonyms: Dlg2, Dlgh2, Pals4, D11Bwg0652e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 50997
Homologene: 3920
Name: StAR-related lipid transfer (START) domain containing 13
Synonyms: GT650, DLC2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 243362
Homologene: 64844
Name: transmembrane protein 132A
Synonyms: 6720481D13Rik, Hspa5bp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 98170
Homologene: 75076
Name: SRY (sex determining region Y)-box 13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20668
Homologene: 4159
Name: tight junction protein 3
Synonyms: ZO-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 27375
VEGA: 10
Homologene: 8458
Name: UDP glucuronosyltransferase 2 family, polypeptide B34
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100727
Homologene: 117389
Name: ATPase type 13A2
Synonyms: 1110012E06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 74772
Homologene: 56940
Name: tubulin tyrosine ligase-like 1
Synonyms: 6330444E16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 319953
Homologene: 8174
Name: TraB domain containing 2B
Synonyms: Gm12824, Hkat
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 666048
Homologene: 85034
Name: eukaryotic translation initiation factor 3, subunit I
Synonyms: D4Ertd632e, 36kDa, Eif3s2, TRIP-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 54709
Homologene: 2786
Name: cytochrome P450, family 2, subfamily d, polypeptide 34
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223706
VEGA: 15
Homologene: 86099
Name: cytosolic arginine sensor for mTORC1 subunit 2
Synonyms: Gats, Gatsl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 80909
Homologene: 84866
Name: troponin T2, cardiac
Synonyms: Tnt, cTnT, cardiac TnT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 21956
Homologene: 68050
Name: opticin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 269120
Homologene: 8652
Name: GTP binding protein 2
Synonyms: nmf205
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 56055
Homologene: 10420
Name: proline arginine-rich end leucine-rich repeat
Synonyms: 7330409J17Rik, SLRR2A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 116847
Homologene: 2041
Name: olfactory receptor family 1 subfamily J member 13
Synonyms: GA_x6K02T2NLDC-33174915-33173974, MOR136-2, Olfr341
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258952
Homologene: 74160
Name: cytochrome P450, family 4, subfamily a, polypeptide 14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 13119
Homologene: 134697
Name: lactoperoxidase
Synonyms: 5830499B15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 76113
Homologene: 21240
Name: olfactory receptor family 2 subfamily F member 1
Synonyms: GA_x6K02T2P3E9-4815856-4814903, MOR257-8P, Olfr453
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 258016
Homologene: 128151
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 9
Synonyms: CSNU3, bo, +AT, bo, + amino acid transporter
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 30962
Homologene: 56668
Name: golgi integral membrane protein 4
Synonyms: GPP130, P138, 3110027H23Rik, Golph4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 73124
Homologene: 8716
Name: epilepsy, progressive myoclonic epilepsy, type 2 gene alpha
Synonyms: laforin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 13853
Homologene: 38087
Name: G protein-coupled receptor 132
Synonyms: G2 accumulation, G2a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 56696
VEGA: 12
Homologene: 8350
Name: calcium/calmodulin-dependent protein kinase II, beta
Synonyms: CaMK II
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 12323
Homologene: 111050
Name: KiSS-1 metastasis-suppressor
Synonyms: metastin, kisspeptin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 280287
Homologene: 1701
Name: intraflagellar transport 20
Synonyms: 0610009H04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 55978
Homologene: 49559
Name: predicted gene 1587
Synonyms: LOC380920
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 380920
VEGA: 14
Name: lactate dehydrogenase C
Synonyms: Ldh-3, Ldh3, Ldhc4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16833
Homologene: 22767
Name: tetratricopeptide repeat domain 9B
Synonyms: 2900074C18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 73032
Homologene: 19938
Name: guanylate cyclase activator 2b (retina)
Synonyms: uroguanylin, Gcap2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 14916
Homologene: 5150
Name: ribosomal RNA processing 1
Synonyms: NNP-1, Nnp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 18114
VEGA: 10
Name: mastermind-like domain containing 1
Synonyms: G630014P10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 333639
Homologene: 135712
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 21,226,059 bp
  • T to G, chromosome 1 at 40,607,741 bp
  • A to G, chromosome 1 at 58,169,843 bp
  • ACTCTCTCTCTCTCTCT to ACTCTCTCTCTCTCTCTCT, chromosome 1 at 131,663,285 bp
  • C to A, chromosome 1 at 133,279,365 bp
  • AGTG to AGTGGCACCTTTGGTG, chromosome 1 at 133,327,321 bp
  • C to A, chromosome 1 at 133,358,982 bp
  • G to A, chromosome 1 at 133,387,071 bp
  • A to T, chromosome 1 at 133,903,796 bp
  • C to T, chromosome 1 at 133,915,131 bp
  • ACTCTCTCT to ACTCTCTCTCT, chromosome 1 at 134,746,741 bp
  • AG to AGG, chromosome 1 at 134,971,364 bp
  • ATCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTCCTC, chromosome 1 at 135,386,268 bp
  • TCC to TCCACC, chromosome 1 at 135,386,275 bp
  • A to G, chromosome 1 at 135,402,250 bp
  • TG to TGG, chromosome 1 at 135,846,761 bp
  • AGGG to AGG, chromosome 1 at 135,974,852 bp
  • CC to CCGAC, chromosome 1 at 136,490,395 bp
  • T to C, chromosome 1 at 143,760,034 bp
  • C to T, chromosome 1 at 155,225,786 bp
  • A to G, chromosome 2 at 36,480,047 bp
  • A to T, chromosome 2 at 37,378,916 bp
  • T to A, chromosome 2 at 49,758,805 bp
  • A to T, chromosome 2 at 69,323,883 bp
  • T to A, chromosome 2 at 76,586,214 bp
  • G to A, chromosome 2 at 76,850,612 bp
  • G to A, chromosome 2 at 77,059,607 bp
  • G to A, chromosome 2 at 89,575,256 bp
  • T to C, chromosome 2 at 103,981,062 bp
  • A to G, chromosome 2 at 128,967,830 bp
  • T to A, chromosome 2 at 135,325,667 bp
  • A to T, chromosome 2 at 156,095,510 bp
  • A to G, chromosome 2 at 168,940,743 bp
  • T to C, chromosome 3 at 40,970,535 bp
  • A to T, chromosome 3 at 75,908,149 bp
  • G to A, chromosome 3 at 87,810,572 bp
  • T to A, chromosome 3 at 103,735,869 bp
  • T to A, chromosome 3 at 108,351,686 bp
  • T to A, chromosome 3 at 116,539,124 bp
  • C to A, chromosome 4 at 62,327,899 bp
  • A to T, chromosome 4 at 89,688,709 bp
  • A to G, chromosome 4 at 100,410,025 bp
  • A to G, chromosome 4 at 109,710,845 bp
  • A to T, chromosome 4 at 114,610,008 bp
  • A to T, chromosome 4 at 115,491,391 bp
  • T to C, chromosome 4 at 119,657,631 bp
  • A to T, chromosome 4 at 124,785,168 bp
  • A to T, chromosome 4 at 129,596,926 bp
  • T to A, chromosome 4 at 141,005,016 bp
  • G to A, chromosome 4 at 141,928,400 bp
  • C to T, chromosome 5 at 86,906,557 bp
  • TGGGG to TGGG, chromosome 5 at 114,209,767 bp
  • G to A, chromosome 5 at 134,136,153 bp
  • C to T, chromosome 5 at 144,174,988 bp
  • T to A, chromosome 5 at 144,208,645 bp
  • T to C, chromosome 5 at 151,045,168 bp
  • T to C, chromosome 6 at 33,758,158 bp
  • T to C, chromosome 6 at 33,910,538 bp
  • C to A, chromosome 6 at 42,744,135 bp
  • T to C, chromosome 6 at 47,298,445 bp
  • A to G, chromosome 6 at 89,145,469 bp
  • C to T, chromosome 6 at 90,626,381 bp
  • T to C, chromosome 6 at 124,449,503 bp
  • T to C, chromosome 6 at 134,248,754 bp
  • T to A, chromosome 7 at 16,081,663 bp
  • T to A, chromosome 7 at 19,068,106 bp
  • T to A, chromosome 7 at 27,654,349 bp
  • T to C, chromosome 7 at 35,453,493 bp
  • A to T, chromosome 7 at 46,869,599 bp
  • T to A, chromosome 7 at 48,824,644 bp
  • A to T, chromosome 7 at 62,377,738 bp
  • G to T, chromosome 7 at 75,611,434 bp
  • G to A, chromosome 7 at 78,477,935 bp
  • C to T, chromosome 7 at 118,382,047 bp
  • T to C, chromosome 7 at 118,794,575 bp
  • T to A, chromosome 7 at 135,704,241 bp
  • C to A, chromosome 7 at 143,592,474 bp
  • T to C, chromosome 8 at 22,011,077 bp
  • A to T, chromosome 8 at 25,164,493 bp
  • C to A, chromosome 8 at 71,352,162 bp
  • A to T, chromosome 8 at 72,386,868 bp
  • A to T, chromosome 8 at 111,297,402 bp
  • A to T, chromosome 8 at 128,498,516 bp
  • C to T, chromosome 9 at 22,358,604 bp
  • T to C, chromosome 9 at 45,803,183 bp
  • T to A, chromosome 9 at 53,149,512 bp
  • T to C, chromosome 9 at 72,308,005 bp
  • G to A, chromosome 10 at 5,346,808 bp
  • A to G, chromosome 10 at 11,343,682 bp
  • T to C, chromosome 10 at 78,401,894 bp
  • T to A, chromosome 10 at 81,278,054 bp
  • A to G, chromosome 10 at 120,165,177 bp
  • T to G, chromosome 10 at 127,011,892 bp
  • T to A, chromosome 11 at 3,680,302 bp
  • T to C, chromosome 11 at 5,977,880 bp
  • T to A, chromosome 11 at 67,096,864 bp
  • G to C, chromosome 11 at 76,211,050 bp
  • G to A, chromosome 11 at 78,540,034 bp
  • A to T, chromosome 11 at 87,583,436 bp
  • T to A, chromosome 11 at 87,821,130 bp
  • A to G, chromosome 11 at 101,775,417 bp
  • G to A, chromosome 11 at 102,064,595 bp
  • T to A, chromosome 11 at 107,670,484 bp
  • A to G, chromosome 11 at 115,881,791 bp
  • A to G, chromosome 11 at 116,358,694 bp
  • T to C, chromosome 12 at 17,321,611 bp
  • A to T, chromosome 12 at 28,746,598 bp
  • T to A, chromosome 12 at 79,268,434 bp
  • T to C, chromosome 12 at 102,394,908 bp
  • A to G, chromosome 12 at 112,852,403 bp
  • T to C, chromosome 13 at 34,913,680 bp
  • T to A, chromosome 13 at 107,743,987 bp
  • T to A, chromosome 14 at 12,211,637 bp
  • A to G, chromosome 14 at 27,476,614 bp
  • T to C, chromosome 14 at 32,325,934 bp
  • T to A, chromosome 14 at 64,233,928 bp
  • T to C, chromosome 14 at 70,638,487 bp
  • A to T, chromosome 14 at 77,794,856 bp
  • A to T, chromosome 14 at 99,079,877 bp
  • T to C, chromosome 15 at 44,516,185 bp
  • T to A, chromosome 15 at 74,529,908 bp
  • A to G, chromosome 15 at 82,618,501 bp
  • A to G, chromosome 15 at 83,505,235 bp
  • T to A, chromosome 15 at 98,075,967 bp
  • A to T, chromosome 15 at 99,243,375 bp
  • G to A, chromosome 16 at 16,053,273 bp
  • A to G, chromosome 17 at 25,383,528 bp
  • G to A, chromosome 17 at 34,879,902 bp
  • T to C, chromosome 17 at 43,624,833 bp
  • T to C, chromosome 17 at 46,161,202 bp
  • A to G, chromosome 17 at 48,090,452 bp
  • T to C, chromosome 17 at 52,893,933 bp
  • A to T, chromosome 17 at 57,027,832 bp
  • G to A, chromosome 18 at 13,844,705 bp
  • T to C, chromosome 18 at 33,874,195 bp
  • C to A, chromosome 18 at 34,312,045 bp
  • C to A, chromosome 18 at 37,447,870 bp
  • T to C, chromosome 18 at 60,602,895 bp
  • T to C, chromosome 18 at 80,117,308 bp
  • T to C, chromosome 18 at 82,621,304 bp
  • C to A, chromosome 19 at 10,864,066 bp
  • A to G, chromosome 19 at 59,464,033 bp
  • C to A, chromosome X at 71,119,392 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact Older strains may not have this information.
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2133 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040136-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.