Strain Name:
C57BL/6J-MtgxR2142Btlr/Mmmh
Stock Number:
040145-MU
Citation ID:
RRID:MMRRC_040145-MU
Other Names:
R2142 (G1), C57BL/6J-MtgxR2142Btlr
Major Collection:

Gene Information

Myo10
Name: myosin X
Synonyms: D15Ertd600e, myosin-X
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 17909
HGNC: HGNC:7593
Homologene: 36328
Myh7
Name: myosin, heavy polypeptide 7, cardiac muscle, beta
Synonyms: Myhc-b, B-MHC, MyHC-I, beta-MHC, MYH-beta/slow, Myhcb, betaMHC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 140781
HGNC: HGNC:7577
Homologene: 68044
Angpt2
Name: angiopoietin 2
Synonyms: Ang2, Ang-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 11601
HGNC: HGNC:485
Homologene: 22401
Gabarap
Name: gamma-aminobutyric acid receptor associated protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 56486
HGNC: HGNC:4067
Homologene: 134119
Efnb1
Name: ephrin B1
Synonyms: LERK-2, Stra1, Lerk2, Eplg2, Epl2, Elk-L, EFL-3, Cek5 ligand, Cek5-L
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 13641
HGNC: HGNC:3226
Homologene: 3263
Jarid2
Name: jumonji, AT rich interactive domain 2
Synonyms: Jmj, jumonji
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 16468
HGNC: HGNC:6196
Homologene: 31279
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: trabeculin alpha, Aclp7, Acf7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 11426
Homologene: 136191
Nup188
Name: nucleoporin 188
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 227699
Homologene: 45683
Plcb4
Name: phospholipase C, beta 4
Synonyms: C230058B11Rik, A930039J07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18798
HGNC: HGNC:9059
Homologene: 8471
Pdzd2
Name: PDZ domain containing 2
Synonyms: LOC223364, A930022H17Rik, Pdzk3, 4930537L06Rik, Gm21706
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 68070
Homologene: 23393
Thbs3
Name: thrombospondin 3
Synonyms: TSP3, Thbs-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 21827
Homologene: 5159
Serpina9
Name: serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9
Synonyms: Centerin, 2310014L03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 71907
Homologene: 23633
Clcn6
Name: chloride channel, voltage-sensitive 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 26372
HGNC: HGNC:2024
Homologene: 985
Psme4
Name: proteasome (prosome, macropain) activator subunit 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 103554
Homologene: 113742
Baz1b
Name: bromodomain adjacent to zinc finger domain, 1B
Synonyms: Wbscr9, WSTF
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 22385
HGNC: HGNC:961
Homologene: 22651
Zfp638
Name: zinc finger protein 638
Synonyms: Np220, Zfml
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 18139
Homologene: 7447
Xrcc6
Name: X-ray repair complementing defective repair in Chinese hamster cells 6
Synonyms: Ku p70, G22p1, Ku70
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 14375
HGNC: HGNC:4055
Homologene: 37483
Sart3
Name: squamous cell carcinoma antigen recognized by T cells 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 53890
Homologene: 40977
Laptm4b
Name: lysosomal-associated protein transmembrane 4B
Synonyms: C330023P13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 114128
VEGA: 15
Homologene: 10182
Uhrf1bp1l
Name: UHRF1 (ICBP90) binding protein 1-like
Synonyms: 2010319N22Rik, 4930506D01Rik, E030041M21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 75089
VEGA: 10
Homologene: 12590
Mical3
Name: microtubule associated monooxygenase, calponin and LIM domain containing 3
Synonyms: MICAL-3, C130040D16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 194401
Homologene: 85288
Mki67
Name: antigen identified by monoclonal antibody Ki 67
Synonyms: Ki-67, Ki67, D630048A14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 17345
HGNC: HGNC:7107
Homologene: 1814
Ubap1
Name: ubiquitin-associated protein 1
Synonyms: NAG20, 2700092A01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 67123
Homologene: 9554
Kif18a
Name: kinesin family member 18A
Synonyms: gcd2, N-8 kinesin, B130001M12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228421
Homologene: 41820
Afdn
Name: afadin, adherens junction formation factor
Synonyms: Afadin, I-afadin, S-afadin, Mllt4, 5033403D15Rik, AF6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 17356
HGNC: HGNC:7137
Homologene: 21202
Ddb1
Name: damage specific DNA binding protein 1
Synonyms: p127-Ddb1, DNA repair protein, damage-specific DNA-binding protein, DNA repair
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 13194
VEGA: 19
HGNC: HGNC:2717
Homologene: 1448
Slitrk6
Name: SLIT and NTRK-like family, member 6
Synonyms: 4832410J21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 239250
VEGA: 14
Homologene: 12986
Huwe1
Name: HECT, UBA and WWE domain containing 1
Synonyms: Ureb1, Ib772, Mule, LOC382250, Arf-bp1, 5430439H10Rik, C430014N20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 59026
Homologene: 45994
Crot
Name: carnitine O-octanoyltransferase
Synonyms: 1200003H03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 74114
HGNC: HGNC:2366
Homologene: 10899
Nat10
Name: N-acetyltransferase 10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 98956
Homologene: 6785
Ipo9
Name: importin 9
Synonyms: 0710008K06Rik, Imp9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226432
Homologene: 5874
Zfp281
Name: zinc finger protein 281
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226442
Homologene: 8270
Cd55
Name: CD55 molecule, decay accelerating factor for complement
Synonyms: complement-glycosylphosphatidylinositol, Cromer blood group, Daf-GPI, GPI-DAF, Daf1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13136
HGNC: HGNC:2665
Homologene: 479
Ndel1
Name: nudE neurodevelopment protein 1 like 1
Synonyms: mNudel, 2600006O07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 83431
Homologene: 32567
Ubr4
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: 1810009A16Rik, LOC381562, A930005E13Rik, p600, Zubr1, D930005K06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 69116
Homologene: 10804
Gprasp1
Name: G protein-coupled receptor associated sorting protein 1
Synonyms: GASP1, 2210415K24Rik, 3110031O14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 67298
Homologene: 8809
Syt2
Name: synaptotagmin II
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20980
Homologene: 22516
Btnl9
Name: butyrophilin-like 9
Synonyms: D330012D11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237754
Homologene: 68540
Fuca2
Name: fucosidase, alpha-L- 2, plasma
Synonyms: 0610025O11Rik, 5530401P20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 66848
HGNC: HGNC:4008
Homologene: 119
Dck
Name: deoxycytidine kinase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 13178
HGNC: HGNC:2704
Homologene: 616
Zfp65
Name: zinc finger protein 65
Synonyms: KRAB5, Zfp71-rs1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 235907
Homologene: 87875
Grk6
Name: G protein-coupled receptor kinase 6
Synonyms: Gprk6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 26385
VEGA: 13
HGNC: HGNC:4545
Homologene: 37570
Abcf3
Name: ATP-binding cassette, sub-family F (GCN20), member 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 27406
HGNC: HGNC:72
Homologene: 22784
Cntrl
Name: centriolin
Synonyms: Cep110, IB3/5, Ma2a8, Cep1, b2b1468Clo, 6720467O09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 26920
HGNC: HGNC:1858
Homologene: 38260
Aagab
Name: alpha- and gamma-adaptin binding protein
Synonyms: 2310007F21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 66939
VEGA: 9
Homologene: 11648
Elf2
Name: E74-like factor 2
Synonyms: 2610036A20Rik, A230104O07Rik, NERF-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 69257
HGNC: HGNC:3317
Homologene: 5006
Esco1
Name: establishment of sister chromatid cohesion N-acetyltransferase 1
Synonyms: A930014I12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 77805
Homologene: 62166
Pot1a
Name: protection of telomeres 1A
Synonyms: 1500031H18Rik, Pot1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 101185
Homologene: 32263
Nrbp1
Name: nuclear receptor binding protein 1
Synonyms: B230344L17Rik, Nrbp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 192292
HGNC: HGNC:7993
Homologene: 8373
Itpkc
Name: inositol 1,4,5-trisphosphate 3-kinase C
Synonyms: 9130023N17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233011
Homologene: 11868
Zfp473
Name: zinc finger protein 473
Synonyms: D030014N22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 243963
Homologene: 18698
Tarsl2
Name: threonyl-tRNA synthetase-like 2
Synonyms: A530046H20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 272396
Homologene: 65036
Gemin4
Name: gem nuclear organelle associated protein 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 276919
Homologene: 69193
Mgat5b
Name: mannoside acetylglucosaminyltransferase 5, isoenzyme B
Synonyms: GnT-IX
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 268510
Homologene: 27821
Ube2t
Name: ubiquitin-conjugating enzyme E2T
Synonyms: 2700084L22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67196
Homologene: 40929
Rorc
Name: RAR-related orphan receptor gamma
Synonyms: thymus orphan receptor, RORgamma, Thor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 19885
Homologene: 21051
Sall3
Name: spalt like transcription factor 3
Synonyms: Spalt, B130022O04Rik, Msal, Msal-1, Salt
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 20689
VEGA: 18
Homologene: 18142
Atp6v0a4
Name: ATPase, H+ transporting, lysosomal V0 subunit A4
Synonyms: Atp6n1b, V-ATPase alpha 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 140494
HGNC: HGNC:866
Homologene: 39904
Lama2
Name: laminin, alpha 2
Synonyms: merosin, mer
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 16773
HGNC: HGNC:6482
Homologene: 37306
Adgrf4
Name: adhesion G protein-coupled receptor F4
Synonyms: 4632435A09Rik, Gpr115
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 78249
Homologene: 51953
Fbn1
Name: fibrillin 1
Synonyms: Fib-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14118
HGNC: HGNC:3603
Homologene: 30958
Ttn
Name: titin
Synonyms: D830007G01Rik, 2310057K23Rik, L56, shru, connectin, 2310074I15Rik, mdm, 2310036G12Rik, 1100001C23Rik, D330041I19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Pkhd1
Name: polycystic kidney and hepatic disease 1
Synonyms: tigmin, FPC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 241035
HGNC: HGNC:9016
Homologene: 16336
4932431P20Rik
Name: RIKEN cDNA 4932431P20 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 114675
Pcdhb11
Name: protocadherin beta 11
Synonyms: Pcdhb5E, PcdhbK
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93882
Homologene: 62178
Adgrb3
Name: adhesion G protein-coupled receptor B3
Synonyms: A830096D10Rik, Bai3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 210933
HGNC: HGNC:945
Homologene: 1289
Cdh8
Name: cadherin 8
Synonyms: cad8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 12564
HGNC: HGNC:1767
Homologene: 55604
Helz2
Name: helicase with zinc finger 2, transcriptional coactivator
Synonyms: BC006779
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 229003
Homologene: 14118
Myh2
Name: myosin, heavy polypeptide 2, skeletal muscle, adult
Synonyms: Myhsf1, MyHC-IIa, Myhs-f1, MHC2A, Myhs-f
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17882
HGNC: HGNC:7572
Homologene: 23019
Treh
Name: trehalase (brush-border membrane glycoprotein)
Synonyms: 2210412M19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 58866
Homologene: 5198
Man1a
Name: mannosidase 1, alpha
Synonyms: mannosyl-oligosaccharide alpha-1,2-mannosidase, PCR1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 17155
HGNC: HGNC:6821
Homologene: 4316
Tigd4
Name: tigger transposable element derived 4
Synonyms: Tigd4, C130063O11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 403175
Homologene: 131124
Olfr786
Name: olfactory receptor 786
Synonyms: GA_x6K02T2PULF-11116958-11117896, MOR111-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 258542
HGNC: HGNC:8355
Homologene: 133582
Fads2b
Name: fatty acid desaturase 2B
Synonyms: 4833423E24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228151
Homologene: 105643
Gns
Name: glucosamine (N-acetyl)-6-sulfatase
Synonyms: 2610016K11Rik, G6S
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 75612
VEGA: 10
HGNC: HGNC:4422
Homologene: 1568
Micall1
Name: microtubule associated monooxygenase, calponin and LIM domain containing -like 1
Synonyms: D15N2e, Mus EST 820961, D15Mit260
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 27008
VEGA: 15
Homologene: 24911
Olfr1383
Name: olfactory receptor 1383
Synonyms: GA_x6K02T2QP88-5912627-5911692, MOR256-56
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 404337
Homologene: 105344
Elmod3
Name: ELMO/CED-12 domain containing 3
Synonyms: ELMOD3, RBM29, C330008I15Rik, Rbed1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232089
Homologene: 12978
Naaladl1
Name: N-acetylated alpha-linked acidic dipeptidase-like 1
Synonyms: LOC381204
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 381204
Homologene: 21124
Kif14
Name: kinesin family member 14
Synonyms: N-3 kinesin, D1Ertd367e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 381293
Homologene: 8916
Kctd16
Name: potassium channel tetramerisation domain containing 16
Synonyms: LOC383347, 4930434H12Rik, 2900055J20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 73001
VEGA: 18
Homologene: 44779
Vmn2r94
Name: vomeronasal 2, receptor 94
Synonyms: EG665227
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 665227
Homologene: 129751
Dnah7b
Name: dynein, axonemal, heavy chain 7B
Synonyms: Dnahc7b, LOC227058
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 227058
Homologene: 41287
Ces1c
Name: carboxylesterase 1C
Synonyms: Ces-N, Ee-1, Es-4, Es1, Es-1, Es-N
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 13884
HGNC: HGNC:1863
Homologene: 117484
Kdr
Name: kinase insert domain protein receptor
Synonyms: VEGFR-2, vascular endothelial growth factor receptor- 2, Flk1, Flk-1, VEGFR2, VEGF receptor-2, orv
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 16542
HGNC: HGNC:6307
Homologene: 55639
Igfn1
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226438
Homologene: 130054
Bscl2
Name: Berardinelli-Seip congenital lipodystrophy 2 (seipin)
Synonyms: Gng3lg, seipin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 14705
Homologene: 32032
Dsel
Name: dermatan sulfate epimerase-like
Synonyms: DS-epi2, 9330132E09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 319901
Homologene: 12964
Olfr1298
Name: olfactory receptor 1298
Synonyms: MOR248-6, GA_x6K02T2Q125-72697413-72696475
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258888
Homologene: 121521
Mx2
Name: MX dynamin-like GTPase 2
Synonyms: Mx-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 17858
Ren1
Name: renin 1 structural
Synonyms: Rnr, Ren1c, Ren, Ren-1, Ren1d, Rn-1, Ren-A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 19701
HGNC: HGNC:9958
Homologene: 20151
Tdpoz3
Name: TD and POZ domain containing 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 399674
Homologene: 128308
Obsl1
Name: obscurin-like 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 98733
Alkbh2
Name: alkB homolog 2, alpha-ketoglutarate-dependent dioxygenase
Synonyms: Abh2, mABH2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231642
Homologene: 18393
Phkg2
Name: phosphorylase kinase, gamma 2 (testis)
Synonyms: 1500017I02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 68961
HGNC: HGNC:8931
Homologene: 47915
Parp8
Name: poly (ADP-ribose) polymerase family, member 8
Synonyms: 2810430O08Rik, D13Ertd275e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 52552
VEGA: 13
Homologene: 11621
Prb1
Name: proline-rich protein BstNI subfamily 1
Synonyms: proline-rich proteoglycan 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 381833
HGNC: HGNC:9338
Olfr1240
Name: olfactory receptor 1240
Synonyms: MOR231-8, GA_x6K02T2Q125-50883183-50882239
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258804
Homologene: 121591
Ro60
Name: Ro60, Y RNA binding protein
Synonyms: A530054J02Rik, Ssa2, Ssa, Trove2, SS-A/Ro, 1810007I17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20822
Homologene: 3383
AC135640.2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Akr1b7
Name: aldo-keto reductase family 1, member B7
Synonyms: MVDP, Avdp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 11997
Homologene: 122176
Olfr1012
Name: olfactory receptor 1012
Synonyms: MOR213-6, GA_x6K02T2Q125-47239120-47238185
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258561
Homologene: 64889
Olfr642
Name: olfactory receptor 642
Synonyms: GA_x6K02T2PBJ9-6784380-6783436, MOR13-6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258326
Homologene: 17196
Rit2
Name: Ras-like without CAAX 2
Synonyms: Roc2, Rin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 19762
Homologene: 2198
Tas2r115
Name: taste receptor, type 2, member 115
Synonyms: mt2r49, Tas2r15, mGR15, T2R15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 353325
Cfhr2
Name: complement factor H-related 2
Synonyms: FHR-B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 545366
Homologene: 134349
AC164610.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Slc38a3
Name: solute carrier family 38, member 3
Synonyms: D9Ucla2, 0610012J02Rik, Snat3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 76257
Homologene: 4983
Col25a1
Name: collagen, type XXV, alpha 1
Synonyms: 2700062B08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 77018
Homologene: 57111
Gdf2
Name: growth differentiation factor 2
Synonyms: Bmp9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 12165
VEGA: 14
HGNC: HGNC:4217
Homologene: 32299
Kat5
Name: K(lysine) acetyltransferase 5
Synonyms: mHTATIP/CPLA2, PLIP, Htatip, Tip60
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 81601
VEGA: 19
HGNC: HGNC:5275
Homologene: 100661
Rab11fip5
Name: RAB11 family interacting protein 5 (class I)
Synonyms: GAF1, RIP11, D6Ertd32e, 9130206P09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 52055
Homologene: 9158
Cep112
Name: centrosomal protein 112
Synonyms: Ccdc46, 8430407H02Rik, Macoco, 1700001M19Rik, 1700029K01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 76380
Homologene: 44915
Tnnt2
Name: troponin T2, cardiac
Synonyms: cardiac TnT, Tnt, cTnT
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 21956
Homologene: 68050
Optc
Name: opticin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 269120
HGNC: HGNC:8158
Homologene: 8652
Cnksr1
Name: connector enhancer of kinase suppressor of Ras 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 194231
Homologene: 4604
Gm4907
Name: predicted gene 4907
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 236749
Prelp
Name: proline arginine-rich end leucine-rich repeat
Synonyms: 7330409J17Rik, SLRR2A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 116847
HGNC: HGNC:9357
Homologene: 2041
Olfr115
Name: olfactory receptor 115
Synonyms: GA_x6K02T2PSCP-2070203-2069271, MOR218-11P
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 257908
Homologene: 115497
Nipa1
Name: non imprinted in Prader-Willi/Angelman syndrome 1 homolog (human)
Synonyms: Spg6, A830014A18Rik, 1110027G09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233280
Homologene: 42327
Glyatl3
Name: glycine-N-acyltransferase-like 3
Synonyms: Gm5683
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 435528
VEGA: 17
Homologene: 19824
Hmx2
Name: H6 homeobox 2
Synonyms: Nkx5-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 15372
HGNC: HGNC:5018
Homologene: 24625
Gm266
Name: predicted gene 266
Synonyms: LOC212539
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 212539
VEGA: 12
Homologene: 19334
Zfp606
Name: zinc finger protein 606
Synonyms: 2410022M24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 67370
Homologene: 23514
Panx3
Name: pannexin 3
Synonyms: 4833413G11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 208098
Homologene: 82335
Ift20
Name: intraflagellar transport 20
Synonyms: 0610009H04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 55978
Homologene: 49559
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 20,523,895 bp
  • G to T, chromosome 1 at 25,068,209 bp
  • T to A, chromosome 1 at 46,268,670 bp
  • G to A, chromosome 1 at 75,486,756 bp
  • T to C, chromosome 1 at 111,859,457 bp
  • C to T, chromosome 1 at 130,449,423 bp
  • C to G, chromosome 1 at 133,350,778 bp
  • A to T, chromosome 1 at 133,903,796 bp
  • C to T, chromosome 1 at 133,915,131 bp
  • ACTCTCTCT to ACTCTCTCTCT, chromosome 1 at 134,746,741 bp
  • AG to AGG, chromosome 1 at 134,971,364 bp
  • ATCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTCCTC, chromosome 1 at 135,386,268 bp
  • TCC to TCCGCC, chromosome 1 at 135,386,275 bp
  • CCT to CCTTCT, chromosome 1 at 135,386,282 bp
  • A to G, chromosome 1 at 135,402,250 bp
  • TG to TGG, chromosome 1 at 135,846,761 bp
  • AGGG to AGG, chromosome 1 at 135,974,852 bp
  • CC to CCGAC, chromosome 1 at 136,490,395 bp
  • GCGGCAGCTCCGGCAGC to GCGGCAGCTCCGGCAGCTCCGGCAGC, chromosome 1 at 136,625,353 bp
  • T to G, chromosome 1 at 139,831,155 bp
  • T to C, chromosome 1 at 143,760,034 bp
  • T to A, chromosome 2 at 30,336,706 bp
  • CAGAG to CAG, chromosome 2 at 35,122,806 bp
  • C to T, chromosome 2 at 76,813,339 bp
  • T to C, chromosome 2 at 85,508,337 bp
  • C to T, chromosome 2 at 85,759,677 bp
  • C to T, chromosome 2 at 89,439,583 bp
  • T to C, chromosome 2 at 103,731,303 bp
  • T to A, chromosome 2 at 109,333,503 bp
  • C to A, chromosome 2 at 111,645,221 bp
  • T to G, chromosome 2 at 125,412,708 bp
  • G to A, chromosome 2 at 135,976,099 bp
  • T to C, chromosome 2 at 181,231,380 bp
  • A to G, chromosome 3 at 51,256,440 bp
  • A to G, chromosome 3 at 84,594,363 bp
  • G to T, chromosome 3 at 89,219,376 bp
  • C to T, chromosome 3 at 93,826,899 bp
  • G to A, chromosome 3 at 94,389,526 bp
  • A to G, chromosome 3 at 130,570,316 bp
  • C to T, chromosome 4 at 41,379,257 bp
  • C to T, chromosome 4 at 123,355,102 bp
  • A to G, chromosome 4 at 134,229,628 bp
  • C to T, chromosome 4 at 139,477,207 bp
  • A to G, chromosome 4 at 148,024,137 bp
  • A to T, chromosome 5 at 8,987,780 bp
  • A to G, chromosome 5 at 31,247,929 bp
  • T to C, chromosome 5 at 75,968,423 bp
  • T to C, chromosome 5 at 88,772,723 bp
  • T to C, chromosome 5 at 113,764,093 bp
  • C to T, chromosome 5 at 114,125,716 bp
  • G to A, chromosome 5 at 135,217,275 bp
  • T to C, chromosome 6 at 25,750,044 bp
  • T to A, chromosome 6 at 34,417,269 bp
  • T to A, chromosome 6 at 38,082,936 bp
  • A to T, chromosome 6 at 72,587,605 bp
  • T to A, chromosome 6 at 83,986,596 bp
  • T to C, chromosome 6 at 85,337,228 bp
  • A to T, chromosome 6 at 121,031,134 bp
  • T to A, chromosome 6 at 132,207,203 bp
  • T to C, chromosome 6 at 132,737,358 bp
  • A to G, chromosome 6 at 133,529,275 bp
  • T to C, chromosome 7 at 12,479,726 bp
  • A to G, chromosome 7 at 27,219,650 bp
  • T to C, chromosome 7 at 29,531,510 bp
  • T to C, chromosome 7 at 44,733,077 bp
  • C to A, chromosome 7 at 55,997,511 bp
  • A to T, chromosome 7 at 65,658,897 bp
  • C to T, chromosome 7 at 104,050,300 bp
  • T to A, chromosome 7 at 106,329,956 bp
  • G to A, chromosome 7 at 127,582,214 bp
  • A to T, chromosome 7 at 131,555,859 bp
  • A to G, chromosome 7 at 135,695,592 bp
  • T to C, chromosome 8 at 18,714,140 bp
  • T to A, chromosome 8 at 93,130,840 bp
  • C to A, chromosome 8 at 99,111,693 bp
  • G to C, chromosome 9 at 37,666,673 bp
  • G to A, chromosome 9 at 44,681,141 bp
  • T to A, chromosome 9 at 63,616,675 bp
  • C to T, chromosome 9 at 107,658,762 bp
  • A to G, chromosome 10 at 13,505,865 bp
  • A to G, chromosome 10 at 27,616,690 bp
  • T to C, chromosome 10 at 53,934,998 bp
  • A to G, chromosome 10 at 89,812,048 bp
  • G to A, chromosome 10 at 121,392,778 bp
  • A to G, chromosome 10 at 129,437,747 bp
  • A to G, chromosome 11 at 30,820,998 bp
  • G to T, chromosome 11 at 49,170,626 bp
  • A to G, chromosome 11 at 49,523,839 bp
  • A to G, chromosome 11 at 67,189,332 bp
  • CAAATAAATAAATAAATAAATAAATAAATAAATAAA to CAAATAAATAAATAAATAAATAAATAAATAAATAAATAAA, chromosome 11 at 68,829,866 bp
  • C to T, chromosome 11 at 69,991,689 bp
  • G to C, chromosome 11 at 76,211,050 bp
  • G to A, chromosome 11 at 78,540,034 bp
  • A to G, chromosome 11 at 108,606,325 bp
  • T to C, chromosome 11 at 116,977,670 bp
  • T to C, chromosome 12 at 104,008,309 bp
  • C to T, chromosome 12 at 111,485,181 bp
  • T to A, chromosome 13 at 44,906,276 bp
  • T to C, chromosome 13 at 55,454,364 bp
  • G to T, chromosome 13 at 67,708,192 bp
  • T to A, chromosome 13 at 116,894,886 bp
  • A to G, chromosome 14 at 33,945,241 bp
  • A to G, chromosome 14 at 54,990,910 bp
  • T to G, chromosome 14 at 110,750,794 bp
  • C to A, chromosome 15 at 12,406,559 bp
  • A to G, chromosome 15 at 25,714,108 bp
  • G to T, chromosome 15 at 34,238,332 bp
  • T to C, chromosome 15 at 76,183,174 bp
  • T to C, chromosome 15 at 79,130,795 bp
  • T to A, chromosome 15 at 82,022,977 bp
  • T to A, chromosome 16 at 20,551,637 bp
  • G to A, chromosome 16 at 97,538,703 bp
  • A to G, chromosome 17 at 13,810,433 bp
  • T to A, chromosome 17 at 18,253,372 bp
  • T to G, chromosome 17 at 37,610,471 bp
  • T to C, chromosome 17 at 40,911,084 bp
  • C to T, chromosome 17 at 42,666,898 bp
  • A to G, chromosome 18 at 10,574,873 bp
  • A to G, chromosome 18 at 31,153,713 bp
  • A to G, chromosome 18 at 37,422,123 bp
  • A to G, chromosome 18 at 40,259,178 bp
  • A to T, chromosome 18 at 80,969,831 bp
  • T to A, chromosome 19 at 5,605,685 bp
  • T to A, chromosome 19 at 6,106,811 bp
  • T to C, chromosome 19 at 8,845,320 bp
  • T to C, chromosome 19 at 10,619,126 bp
  • T to A, chromosome X at 23,907,310 bp
  • A to G, chromosome X at 99,147,517 bp
  • G to A, chromosome X at 135,802,042 bp
  • G to T, chromosome X at 151,862,641 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2142 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
040145-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.