Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2142Btlr/Mmmh
Stock Number:
040145-MU
Citation ID:
RRID:MMRRC_040145-MU
Other Names:
R2142 (G1), C57BL/6J-MtgxR2142Btlr
Major Collection:

Strain Information

Myo10
Name: myosin X
Synonyms: myosin-X, D15Ertd600e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17909
HGNC: HGNC:7593
Homologene: 36328
Myh7
Name: myosin, heavy polypeptide 7, cardiac muscle, beta
Synonyms: Myhc-b, Myhcb, beta-MHC, B-MHC, MYH-beta/slow, MyHC-I, betaMHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 140781
HGNC: HGNC:7577
Homologene: 68044
Angpt2
Name: angiopoietin 2
Synonyms: Ang2, Ang-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11601
HGNC: HGNC:485
Homologene: 22401
Gabarap
Name: gamma-aminobutyric acid receptor associated protein
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56486
HGNC: HGNC:4067
Homologene: 134119
Efnb1
Name: ephrin B1
Synonyms: Stra1, LERK-2, Cek5 ligand, Epl2, Cek5-L, EFL-3, Elk-L, Eplg2, Lerk2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 13641
HGNC: HGNC:3226
Homologene: 3263
Jarid2
Name: jumonji and AT-rich interaction domain containing 2
Synonyms: Jmj, jumonji
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16468
HGNC: HGNC:6196
Homologene: 31279
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 20,523,895 bp
  • G to T, chromosome 1 at 25,068,209 bp
  • T to A, chromosome 1 at 46,268,670 bp
  • G to A, chromosome 1 at 75,486,756 bp
  • T to C, chromosome 1 at 111,859,457 bp
  • C to T, chromosome 1 at 130,449,423 bp
  • C to G, chromosome 1 at 133,350,778 bp
  • A to T, chromosome 1 at 133,903,796 bp
  • C to T, chromosome 1 at 133,915,131 bp
  • ACTCTCTCT to ACTCTCTCTCT, chromosome 1 at 134,746,741 bp
  • AG to AGG, chromosome 1 at 134,971,364 bp
  • ATCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTCCTC, chromosome 1 at 135,386,268 bp
  • TCC to TCCGCC, chromosome 1 at 135,386,275 bp
  • CCT to CCTTCT, chromosome 1 at 135,386,282 bp
  • A to G, chromosome 1 at 135,402,250 bp
  • TG to TGG, chromosome 1 at 135,846,761 bp
  • AGGG to AGG, chromosome 1 at 135,974,852 bp
  • CC to CCGAC, chromosome 1 at 136,490,395 bp
  • GCGGCAGCTCCGGCAGC to GCGGCAGCTCCGGCAGCTCCGGCAGC, chromosome 1 at 136,625,353 bp
  • T to G, chromosome 1 at 139,831,155 bp
  • T to C, chromosome 1 at 143,760,034 bp
  • T to A, chromosome 2 at 30,336,706 bp
  • CAGAG to CAG, chromosome 2 at 35,122,806 bp
  • C to T, chromosome 2 at 76,813,339 bp
  • T to C, chromosome 2 at 85,508,337 bp
  • C to T, chromosome 2 at 85,759,677 bp
  • C to T, chromosome 2 at 89,439,583 bp
  • T to C, chromosome 2 at 103,731,303 bp
  • T to A, chromosome 2 at 109,333,503 bp
  • C to A, chromosome 2 at 111,645,221 bp
  • T to G, chromosome 2 at 125,412,708 bp
  • G to A, chromosome 2 at 135,976,099 bp
  • T to C, chromosome 2 at 181,231,380 bp
  • A to G, chromosome 3 at 51,256,440 bp
  • A to G, chromosome 3 at 84,594,363 bp
  • G to T, chromosome 3 at 89,219,376 bp
  • C to T, chromosome 3 at 93,826,899 bp
  • G to A, chromosome 3 at 94,389,526 bp
  • A to G, chromosome 3 at 130,570,316 bp
  • C to T, chromosome 4 at 41,379,257 bp
  • C to T, chromosome 4 at 123,355,102 bp
  • A to G, chromosome 4 at 134,229,628 bp
  • C to T, chromosome 4 at 139,477,207 bp
  • A to G, chromosome 4 at 148,024,137 bp
  • A to T, chromosome 5 at 8,987,780 bp
  • A to G, chromosome 5 at 31,247,929 bp
  • T to C, chromosome 5 at 75,968,423 bp
  • T to C, chromosome 5 at 88,772,723 bp
  • T to C, chromosome 5 at 113,764,093 bp
  • C to T, chromosome 5 at 114,125,716 bp
  • G to A, chromosome 5 at 135,217,275 bp
  • T to C, chromosome 6 at 25,750,044 bp
  • T to A, chromosome 6 at 34,417,269 bp
  • T to A, chromosome 6 at 38,082,936 bp
  • A to T, chromosome 6 at 72,587,605 bp
  • T to A, chromosome 6 at 83,986,596 bp
  • T to C, chromosome 6 at 85,337,228 bp
  • A to T, chromosome 6 at 121,031,134 bp
  • T to A, chromosome 6 at 132,207,203 bp
  • T to C, chromosome 6 at 132,737,358 bp
  • A to G, chromosome 6 at 133,529,275 bp
  • T to C, chromosome 7 at 12,479,726 bp
  • A to G, chromosome 7 at 27,219,650 bp
  • T to C, chromosome 7 at 29,531,510 bp
  • T to C, chromosome 7 at 44,733,077 bp
  • C to A, chromosome 7 at 55,997,511 bp
  • A to T, chromosome 7 at 65,658,897 bp
  • C to T, chromosome 7 at 104,050,300 bp
  • T to A, chromosome 7 at 106,329,956 bp
  • G to A, chromosome 7 at 127,582,214 bp
  • A to T, chromosome 7 at 131,555,859 bp
  • A to G, chromosome 7 at 135,695,592 bp
  • T to C, chromosome 8 at 18,714,140 bp
  • T to A, chromosome 8 at 93,130,840 bp
  • C to A, chromosome 8 at 99,111,693 bp
  • G to C, chromosome 9 at 37,666,673 bp
  • G to A, chromosome 9 at 44,681,141 bp
  • T to A, chromosome 9 at 63,616,675 bp
  • C to T, chromosome 9 at 107,658,762 bp
  • A to G, chromosome 10 at 13,505,865 bp
  • A to G, chromosome 10 at 27,616,690 bp
  • T to C, chromosome 10 at 53,934,998 bp
  • A to G, chromosome 10 at 89,812,048 bp
  • G to A, chromosome 10 at 121,392,778 bp
  • A to G, chromosome 10 at 129,437,747 bp
  • A to G, chromosome 11 at 30,820,998 bp
  • G to T, chromosome 11 at 49,170,626 bp
  • A to G, chromosome 11 at 49,523,839 bp
  • A to G, chromosome 11 at 67,189,332 bp
  • CAAATAAATAAATAAATAAATAAATAAATAAATAAA to CAAATAAATAAATAAATAAATAAATAAATAAATAAATAAA, chromosome 11 at 68,829,866 bp
  • C to T, chromosome 11 at 69,991,689 bp
  • G to C, chromosome 11 at 76,211,050 bp
  • G to A, chromosome 11 at 78,540,034 bp
  • A to G, chromosome 11 at 108,606,325 bp
  • T to C, chromosome 11 at 116,977,670 bp
  • T to C, chromosome 12 at 104,008,309 bp
  • C to T, chromosome 12 at 111,485,181 bp
  • T to A, chromosome 13 at 44,906,276 bp
  • T to C, chromosome 13 at 55,454,364 bp
  • G to T, chromosome 13 at 67,708,192 bp
  • T to A, chromosome 13 at 116,894,886 bp
  • A to G, chromosome 14 at 33,945,241 bp
  • A to G, chromosome 14 at 54,990,910 bp
  • T to G, chromosome 14 at 110,750,794 bp
  • C to A, chromosome 15 at 12,406,559 bp
  • A to G, chromosome 15 at 25,714,108 bp
  • G to T, chromosome 15 at 34,238,332 bp
  • T to C, chromosome 15 at 76,183,174 bp
  • T to C, chromosome 15 at 79,130,795 bp
  • T to A, chromosome 15 at 82,022,977 bp
  • T to A, chromosome 16 at 20,551,637 bp
  • G to A, chromosome 16 at 97,538,703 bp
  • A to G, chromosome 17 at 13,810,433 bp
  • T to A, chromosome 17 at 18,253,372 bp
  • T to G, chromosome 17 at 37,610,471 bp
  • T to C, chromosome 17 at 40,911,084 bp
  • C to T, chromosome 17 at 42,666,898 bp
  • A to G, chromosome 18 at 10,574,873 bp
  • A to G, chromosome 18 at 31,153,713 bp
  • A to G, chromosome 18 at 37,422,123 bp
  • A to G, chromosome 18 at 40,259,178 bp
  • A to T, chromosome 18 at 80,969,831 bp
  • T to A, chromosome 19 at 5,605,685 bp
  • T to A, chromosome 19 at 6,106,811 bp
  • T to C, chromosome 19 at 8,845,320 bp
  • T to C, chromosome 19 at 10,619,126 bp
  • T to A, chromosome X at 23,907,310 bp
  • A to G, chromosome X at 99,147,517 bp
  • G to A, chromosome X at 135,802,042 bp
  • G to T, chromosome X at 151,862,641 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2142 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040145-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.