Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2519Btlr/Mmmh
Stock Number:
040423-MU
Citation ID:
RRID:MMRRC_040423-MU
Other Names:
R2519 (G1), C57BL/6J-MtgxR2519Btlr
Major Collection:

Strain Information

Adgre1
Name: adhesion G protein-coupled receptor E1
Synonyms: F4/80, DD7A5-7, TM7LN3, EGF-TM7, Ly71, Emr1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13733
VEGA: 17
HGNC: HGNC:3336
Homologene: 1493
Arfgef2
Name: ARF guanine nucleotide exchange factor 2
Synonyms: BIG2, E230011G24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99371
Homologene: 111880
Plcd3
Name: phospholipase C, delta 3
Synonyms: 2610205J15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72469
HGNC: HGNC:9061
Homologene: 14858
Birc2
Name: baculoviral IAP repeat-containing 2
Synonyms: mcIAP1, MIAP1, IAP1, MIHB, Api1, cIAP1, cIAP-1, HIAP1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11797
HGNC: HGNC:590
Homologene: 900
Abtb3
Name: ankyrin repeat and BTB domain containing 3
Synonyms: 6330404E16Rik, Btbd11
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 74007
Homologene: 72536
Topors
Name: topoisomerase I binding, arginine/serine-rich
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 106021
Homologene: 4237
Morc3
Name: microrchidia 3
Synonyms: 1110051N18Rik, D16Jhu32e, 1110051N18Rik, Zcwcc3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 338467
Homologene: 32257
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 79,799,539 bp
  • A to T, chromosome 1 at 150,773,820 bp
  • A to T, chromosome 1 at 162,958,305 bp
  • A to T, chromosome 1 at 188,267,107 bp
  • A to G, chromosome 2 at 85,923,607 bp
  • T to C, chromosome 2 at 130,616,194 bp
  • T to C, chromosome 2 at 166,881,244 bp
  • C to T, chromosome 3 at 5,403,358 bp
  • A to G, chromosome 3 at 84,593,914 bp
  • T to C, chromosome 3 at 104,015,765 bp
  • A to G, chromosome 3 at 107,330,833 bp
  • A to T, chromosome 3 at 108,756,468 bp
  • G to T, chromosome 4 at 40,261,714 bp
  • A to T, chromosome 4 at 43,008,787 bp
  • T to A, chromosome 4 at 138,097,318 bp
  • A to G, chromosome 4 at 148,591,504 bp
  • T to A, chromosome 4 at 155,855,543 bp
  • T to C, chromosome 5 at 9,129,323 bp
  • C to A, chromosome 5 at 22,344,369 bp
  • T to C, chromosome 5 at 44,007,117 bp
  • T to C, chromosome 5 at 90,571,653 bp
  • C to A, chromosome 5 at 111,418,552 bp
  • T to C, chromosome 5 at 117,094,953 bp
  • T to C, chromosome 5 at 120,954,422 bp
  • G to A, chromosome 6 at 41,624,616 bp
  • T to A, chromosome 6 at 41,674,350 bp
  • T to G, chromosome 6 at 42,629,431 bp
  • C to A, chromosome 6 at 85,667,963 bp
  • T to C, chromosome 6 at 88,222,875 bp
  • T to C, chromosome 6 at 122,525,989 bp
  • A to T, chromosome 7 at 5,359,834 bp
  • G to T, chromosome 7 at 16,810,952 bp
  • A to G, chromosome 7 at 27,518,243 bp
  • T to C, chromosome 7 at 40,902,875 bp
  • T to C, chromosome 7 at 66,422,299 bp
  • A to T, chromosome 7 at 118,510,148 bp
  • T to C, chromosome 8 at 22,333,160 bp
  • A to T, chromosome 9 at 7,821,179 bp
  • T to C, chromosome 9 at 21,816,333 bp
  • T to A, chromosome 9 at 38,538,985 bp
  • A to G, chromosome 9 at 75,250,436 bp
  • T to G, chromosome 9 at 78,304,439 bp
  • C to A, chromosome 10 at 14,128,969 bp
  • A to T, chromosome 10 at 24,109,254 bp
  • T to C, chromosome 10 at 70,930,644 bp
  • T to A, chromosome 10 at 85,651,611 bp
  • A to C, chromosome 10 at 86,934,840 bp
  • G to T, chromosome 10 at 121,557,259 bp
  • A to G, chromosome 11 at 48,826,123 bp
  • G to A, chromosome 11 at 53,707,185 bp
  • T to A, chromosome 11 at 74,084,268 bp
  • A to T, chromosome 11 at 103,080,400 bp
  • G to A, chromosome 11 at 105,348,431 bp
  • T to A, chromosome 11 at 106,245,329 bp
  • A to T, chromosome 12 at 80,192,389 bp
  • A to G, chromosome 12 at 80,949,096 bp
  • T to C, chromosome 13 at 49,071,029 bp
  • A to T, chromosome 14 at 31,154,872 bp
  • T to C, chromosome 14 at 60,223,359 bp
  • A to T, chromosome 15 at 39,096,055 bp
  • C to A, chromosome 15 at 55,052,247 bp
  • G to A, chromosome 15 at 82,454,518 bp
  • T to C, chromosome 15 at 100,401,323 bp
  • CTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG to CTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG, chromosome 16 at 32,979,333 bp
  • A to T, chromosome 16 at 35,858,203 bp
  • A to G, chromosome 16 at 93,862,539 bp
  • T to A, chromosome 17 at 18,074,018 bp
  • T to C, chromosome 17 at 19,378,708 bp
  • T to A, chromosome 17 at 21,745,587 bp
  • C to A, chromosome 17 at 35,670,909 bp
  • T to A, chromosome 17 at 42,710,407 bp
  • T to C, chromosome 17 at 57,410,956 bp
  • C to T, chromosome 17 at 71,751,647 bp
  • A to T, chromosome 18 at 31,602,761 bp
  • T to G, chromosome 18 at 36,578,543 bp
  • A to G, chromosome 19 at 18,693,711 bp
  • G to T, chromosome 19 at 33,965,525 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2519 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040423-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.