Strain Name:
C57BL/6J-MtgxR2519Btlr/Mmmh
Stock Number:
040423-MU
Citation ID:
RRID:MMRRC_040423-MU
Other Names:
R2519 (G1), C57BL/6J-MtgxR2519Btlr
Major Collection:

Gene Information

Adgre1
Name: adhesion G protein-coupled receptor E1
Synonyms: Emr1, EGF-TM7, Ly71, DD7A5-7, F4/80, TM7LN3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 13733
VEGA: 17
HGNC: HGNC:3336
Homologene: 1493
Arfgef2
Name: ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)
Synonyms: BIG2, E230011G24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 99371
Homologene: 111880
Plcd3
Name: phospholipase C, delta 3
Synonyms: 2610205J15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 72469
HGNC: HGNC:9061
Homologene: 14858
Birc2
Name: baculoviral IAP repeat-containing 2
Synonyms: HIAP1, IAP1, Api1, MIAP1, mcIAP1, cIAP1, cIAP-1, MIHB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 11797
HGNC: HGNC:590
Homologene: 900
Btbd11
Name: BTB (POZ) domain containing 11
Synonyms: 6330404E16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 74007
Homologene: 72536
Topors
Name: topoisomerase I binding, arginine/serine-rich
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 106021
Homologene: 4237
Morc3
Name: microrchidia 3
Synonyms: 1110051N18Rik, Zcwcc3, D16Jhu32e, 1110051N18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 338467
Homologene: 32257
Dock6
Name: dedicator of cytokinesis 6
Synonyms: 2410095B20Rik, C330023D02Rik, 4931431C02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 319899
VEGA: 9
Homologene: 83291
Eif4g3
Name: eukaryotic translation initiation factor 4 gamma, 3
Synonyms: G1-419-52, 1500002J22Rik, repro8, 4930523M17Rik, eIF4GII
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230861
HGNC: HGNC:3298
Homologene: 2789
Ddx42
Name: DEAD box helicase 42
Synonyms: B430002H05Rik, SF3b125, 1810047H21Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 42
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 72047
Homologene: 49137
Suds3
Name: suppressor of defective silencing 3 homolog (S. cerevisiae)
Synonyms: 2410008L21Rik, 2400003N08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 71954
Homologene: 15906
Dmtf1
Name: cyclin D binding myb-like transcription factor 1
Synonyms: Dmp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 23857
Homologene: 8017
Actn1
Name: actinin, alpha 1
Synonyms: 3110023F10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 109711
VEGA: 12
HGNC: HGNC:163
Homologene: 55553
Carnmt1
Name: carnosine N-methyltransferase 1
Synonyms: 2410127L17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 67383
VEGA: 19
Homologene: 6806
Prom1
Name: prominin 1
Synonyms: AC133, Prom-1, 4932416E19Rik, Prom, CD133
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 19126
HGNC: HGNC:9454
Homologene: 4390
Taf2
Name: TATA-box binding protein associated factor 2
Synonyms: 4732460C16Rik, 150kDa, TAF2B, CIF150, TAFII150
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 319944
VEGA: 15
Homologene: 31137
Rad50
Name: RAD50 double strand break repair protein
Synonyms: Mrell, Rad50l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 19360
HGNC: HGNC:9816
Homologene: 38092
Srsf5
Name: serine and arginine-rich splicing factor 5
Synonyms: Sfrs5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 20384
Homologene: 133842
Slc25a46
Name: solute carrier family 25, member 46
Synonyms: 1200007B05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 67453
VEGA: 18
Homologene: 14518
Bicc1
Name: BicC family RNA binding protein 1
Synonyms: jcpk, Bic-C
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 83675
Homologene: 12856
Rph3a
Name: rabphilin 3A
Synonyms: Doc2 family, 2900002P20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 19894
Homologene: 7921
Alms1
Name: ALMS1, centrosome and basal body associated
Synonyms: Alstrom syndrome 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 236266
HGNC: HGNC:428
Homologene: 49406
Rbm15
Name: RNA binding motif protein 15
Synonyms: C230088J01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229700
Homologene: 23383
Coq7
Name: demethyl-Q 7
Synonyms: clk-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 12850
HGNC: HGNC:2244
Homologene: 6953
Lrch3
Name: leucine-rich repeats and calponin homology (CH) domain containing 3
Synonyms: LOC385628, 2210409B11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 70144
Homologene: 13111
Nupl1
Name: nucleoporin like 1
Synonyms: 1700017F11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 71844
VEGA: 14
Homologene: 40924
Magi3
Name: membrane associated guanylate kinase, WW and PDZ domain containing 3
Synonyms: 6530407C02Rik, 4732496O19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 99470
Homologene: 26431
Tbk1
Name: TANK-binding kinase 1
Synonyms: 1200008B05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 56480
VEGA: 10
Homologene: 22742
Trpv5
Name: transient receptor potential cation channel, subfamily V, member 5
Synonyms: ECaC1, CaT2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 194352
HGNC: HGNC:3145
Homologene: 10520
Slc11a2
Name: solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2
Synonyms: Nramp2, van, DMT1, DCT1, microcytic anemia, viable anaemia
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 18174
Homologene: 55471
Zfhx4
Name: zinc finger homeodomain 4
Synonyms: Zfh4, Zfh-4, C130041O22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 80892
Homologene: 23477
Reln
Name: reelin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 19699
HGNC: HGNC:9957
Homologene: 3699
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 545370
Homologene: 23741
Ush2a
Name: usherin
Synonyms: A930011D15Rik, LOC269160, Ushrn, Ush2a, LOC381317, A930037M10Rik, MUSH2A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 22283
Homologene: 66151
Hivep2
Name: human immunodeficiency virus type I enhancer binding protein 2
Synonyms: MIBP1, Schnurri-2, Gm20114, Shn-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 15273
HGNC: HGNC:4921
Homologene: 4900
Stab2
Name: stabilin 2
Synonyms: FEEL-2, STAB-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 192188
Homologene: 23022
Aknad1
Name: AKNA domain containing 1
Synonyms: 4921525H12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 329738
Homologene: 51892
Tcaf2
Name: TRPM8 channel-associated factor 2
Synonyms: Fam115c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232748
Homologene: 17147
Wnk2
Name: WNK lysine deficient protein kinase 2
Synonyms: ESTM15, X83337, 1810073P09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 75607
Homologene: 19155
Ankhd1
Name: ankyrin repeat and KH domain containing 1
Synonyms: 1110004O12Rik, 4933432B13Rik, A530027J04Rik, 9130019P20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 108857
Homologene: 87006
Stab1
Name: stabilin 1
Synonyms: MS-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 192187
Homologene: 9035
Tigd4
Name: tigger transposable element derived 4
Synonyms: C130063O11Rik, Tigd4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 403175
Homologene: 131124
Mfap5
Name: microfibrillar associated protein 5
Synonyms: MAGP-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 50530
Homologene: 2599
Olfr910
Name: olfactory receptor 910
Synonyms: GA_x6K02T2PVTD-32239063-32239995, MOR165-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258807
VEGA: 9
Homologene: 115510
Albfm1
Name: albumin superfamily member 1
Synonyms: Gm17754, 5830473C10Rik, ARG
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 622307
Homologene: 129803
Slc25a32
Name: solute carrier family 25, member 32
Synonyms: Mftc, 2610043O12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 69906
VEGA: 15
Homologene: 6151
Gtf2h4
Name: general transcription factor II H, polypeptide 4
Synonyms: p52
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 14885
HGNC: HGNC:4658
Homologene: 7090
Gm10639
Name: predicted gene 10639
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 100042314
Homologene: 74378
Myo5c
Name: myosin VC
Synonyms: 9130003O20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 208943
VEGA: 9
HGNC: HGNC:7604
Homologene: 135711
Olfr1026
Name: olfactory receptor 1026
Synonyms: GA_x6K02T2Q125-47402610-47403533, MOR196-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258577
Homologene: 73971
Tpte
Name: transmembrane phosphatase with tensin homology
Synonyms: Pten2, Vsp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234129
Homologene: 50411
Vmn2r99
Name: vomeronasal 2, receptor 99
Synonyms: EG665376
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 665376
Homologene: 115024
Zfp616
Name: zinc finger protein 616
Synonyms: Gm12330
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 327963
Homologene: 88945
Srm
Name: spermidine synthase
Synonyms: SpdST, SpdSy
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 20810
Homologene: 40514
Mrc2
Name: mannose receptor, C type 2
Synonyms: Endo180, novel lectin, uPARAP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 17534
Homologene: 4408
Zfp229
Name: zinc finger protein 229
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 381067
Homologene: 136287
Aldh1a3
Name: aldehyde dehydrogenase family 1, subfamily A3
Synonyms: V1, ALDH6, retinaldehyde dehydrogenase 3, RALDH3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 56847
HGNC: HGNC:409
Homologene: 68080
Parp14
Name: poly (ADP-ribose) polymerase family, member 14
Synonyms: CoaSt6, collaborator of Stat6, 1600029O10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 547253
Homologene: 19697
Vmn2r124
Name: vomeronasal 2, receptor 124
Synonyms: Vmn2r-ps113, Gm7196
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 637021
Homologene: 115024
Pcare
Name: photoreceptor cilium actin regulator
Synonyms: BC027072
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 225004
VEGA: 17
Homologene: 19792
Serpine2
Name: serine (or cysteine) peptidase inhibitor, clade E, member 2
Synonyms: B230326M24Rik, Spi4, PN-1, protease nexin 1, nexin, PI7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20720
HGNC: HGNC:8951
Homologene: 21247
Cyp2d9
Name: cytochrome P450, family 2, subfamily d, polypeptide 9
Synonyms: testosterone 16alpha-hydroxylase, Cyp2d, P450-2D
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 13105
VEGA: 15
Homologene: 86099
Vstm2b
Name: V-set and transmembrane domain containing 2B
Synonyms: 2900093B09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 58188
Homologene: 10970
Adgrf2
Name: adhesion G protein-coupled receptor F2
Synonyms: PGR20, Gpr111
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 435529
Homologene: 45213
Fastkd5
Name: FAST kinase domains 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 380601
Homologene: 36400
Dnajb8
Name: DnaJ heat shock protein family (Hsp40) member B8
Synonyms: 1700016F14Rik, mDj6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 56691
Homologene: 23184
Prx
Name: periaxin
Synonyms: L-Periaxin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 19153
Homologene: 76542
Dvl1
Name: dishevelled segment polarity protein 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 13542
HGNC: HGNC:3084
Homologene: 20926
Fmo3
Name: flavin containing monooxygenase 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 14262
HGNC: HGNC:3771
Homologene: 128199
Mn1
Name: meningioma 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 433938
HGNC: HGNC:7180
Homologene: 37620
Fancg
Name: Fanconi anemia, complementation group G
Synonyms: Xrcc9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 60534
HGNC: HGNC:3588
Homologene: 3402
Gm5065
Name: predicted gene 5065
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 272350
Trpv6
Name: transient receptor potential cation channel, subfamily V, member 6
Synonyms: CAT, Ecac2, Cac, CaT1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 64177
Homologene: 56812
Fkrp
Name: fukutin related protein
Synonyms: A830029B19Rik, MDC1C, LGMD1I
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 243853
Homologene: 11513
Lipf
Name: lipase, gastric
Synonyms: 2310051B21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 67717
HGNC: HGNC:6622
Homologene: 68139
Taar9
Name: trace amine-associated receptor 9
Synonyms: Tar3, Trar3, Ta3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 503558
Homologene: 65286
Gm12184
Name: predicted gene 12184
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 100039945
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 79,799,539 bp
  • A to T, chromosome 1 at 150,773,820 bp
  • A to T, chromosome 1 at 162,958,305 bp
  • A to T, chromosome 1 at 188,267,107 bp
  • A to G, chromosome 2 at 85,923,607 bp
  • T to C, chromosome 2 at 130,616,194 bp
  • T to C, chromosome 2 at 166,881,244 bp
  • C to T, chromosome 3 at 5,403,358 bp
  • A to G, chromosome 3 at 84,593,914 bp
  • T to C, chromosome 3 at 104,015,765 bp
  • A to G, chromosome 3 at 107,330,833 bp
  • A to T, chromosome 3 at 108,756,468 bp
  • G to T, chromosome 4 at 40,261,714 bp
  • A to T, chromosome 4 at 43,008,787 bp
  • T to A, chromosome 4 at 138,097,318 bp
  • A to G, chromosome 4 at 148,591,504 bp
  • T to A, chromosome 4 at 155,855,543 bp
  • T to C, chromosome 5 at 9,129,323 bp
  • C to A, chromosome 5 at 22,344,369 bp
  • T to C, chromosome 5 at 44,007,117 bp
  • T to C, chromosome 5 at 90,571,653 bp
  • C to A, chromosome 5 at 111,418,552 bp
  • T to C, chromosome 5 at 117,094,953 bp
  • T to C, chromosome 5 at 120,954,422 bp
  • G to A, chromosome 6 at 41,624,616 bp
  • T to A, chromosome 6 at 41,674,350 bp
  • T to G, chromosome 6 at 42,629,431 bp
  • C to A, chromosome 6 at 85,667,963 bp
  • T to C, chromosome 6 at 88,222,875 bp
  • T to C, chromosome 6 at 122,525,989 bp
  • A to T, chromosome 7 at 5,359,834 bp
  • G to T, chromosome 7 at 16,810,952 bp
  • A to G, chromosome 7 at 27,518,243 bp
  • T to C, chromosome 7 at 40,902,875 bp
  • T to C, chromosome 7 at 66,422,299 bp
  • A to T, chromosome 7 at 118,510,148 bp
  • T to C, chromosome 8 at 22,333,160 bp
  • A to T, chromosome 9 at 7,821,179 bp
  • T to C, chromosome 9 at 21,816,333 bp
  • T to A, chromosome 9 at 38,538,985 bp
  • A to G, chromosome 9 at 75,250,436 bp
  • T to G, chromosome 9 at 78,304,439 bp
  • C to A, chromosome 10 at 14,128,969 bp
  • A to T, chromosome 10 at 24,109,254 bp
  • T to C, chromosome 10 at 70,930,644 bp
  • T to A, chromosome 10 at 85,651,611 bp
  • A to C, chromosome 10 at 86,934,840 bp
  • G to T, chromosome 10 at 121,557,259 bp
  • A to G, chromosome 11 at 48,826,123 bp
  • G to A, chromosome 11 at 53,707,185 bp
  • T to A, chromosome 11 at 74,084,268 bp
  • A to T, chromosome 11 at 103,080,400 bp
  • G to A, chromosome 11 at 105,348,431 bp
  • T to A, chromosome 11 at 106,245,329 bp
  • A to T, chromosome 12 at 80,192,389 bp
  • A to G, chromosome 12 at 80,949,096 bp
  • T to C, chromosome 13 at 49,071,029 bp
  • A to T, chromosome 14 at 31,154,872 bp
  • T to C, chromosome 14 at 60,223,359 bp
  • A to T, chromosome 15 at 39,096,055 bp
  • C to A, chromosome 15 at 55,052,247 bp
  • G to A, chromosome 15 at 82,454,518 bp
  • T to C, chromosome 15 at 100,401,323 bp
  • CTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG to CTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG, chromosome 16 at 32,979,333 bp
  • A to T, chromosome 16 at 35,858,203 bp
  • A to G, chromosome 16 at 93,862,539 bp
  • T to A, chromosome 17 at 18,074,018 bp
  • T to C, chromosome 17 at 19,378,708 bp
  • T to A, chromosome 17 at 21,745,587 bp
  • C to A, chromosome 17 at 35,670,909 bp
  • T to A, chromosome 17 at 42,710,407 bp
  • T to C, chromosome 17 at 57,410,956 bp
  • C to T, chromosome 17 at 71,751,647 bp
  • A to T, chromosome 18 at 31,602,761 bp
  • T to G, chromosome 18 at 36,578,543 bp
  • A to G, chromosome 19 at 18,693,711 bp
  • G to T, chromosome 19 at 33,965,525 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2519 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
040423-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.