Strain Name:
C57BL/6J-MtgxR2566Btlr/Mmmh
Stock Number:
040425-MU
Citation ID:
RRID:MMRRC_040425-MU
Other Names:
R2566 (G1), C57BL/6J-MtgxR2566Btlr
Major Collection:

Gene Information

Myh7
Name: myosin, heavy polypeptide 7, cardiac muscle, beta
Synonyms: MYH-beta/slow, MyHC-I, Myhc-b, Myhcb, B-MHC, beta-MHC, betaMHC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 140781
HGNC: HGNC:7577
Homologene: 68044
Atic
Name: 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase
Synonyms: 2610509C24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 108147
HGNC: HGNC:794
Homologene: 2983
Rad54l2
Name: RAD54 like 2 (S. cerevisiae)
Synonyms: G630026H09Rik, Srisnf2l, Arip4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 81000
Homologene: 56698
Zfp704
Name: zinc finger protein 704
Synonyms: Gig1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 170753
Homologene: 64370
Rbm6
Name: RNA binding motif protein 6
Synonyms: NY-LU-12, Def-3, g16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 19654
HGNC: HGNC:9903
Homologene: 31336
Ube3c
Name: ubiquitin protein ligase E3C
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 100763
Homologene: 8783
Gars
Name: glycyl-tRNA synthetase
Synonyms: Sgrp23, Gena201, GENA202
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 353172
HGNC: HGNC:4162
Homologene: 1547
Vcl
Name: vinculin
Synonyms: metavinculin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 22330
VEGA: 14
Homologene: 7594
Mrps27
Name: mitochondrial ribosomal protein S27
Synonyms: 2610028H14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 218506
VEGA: 13
Homologene: 41006
Pan2
Name: PAN2 poly(A) specific ribonuclease subunit
Synonyms: 1200014O24Rik, Usp52
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 103135
VEGA: 10
Homologene: 5918
Zfp462
Name: zinc finger protein 462
Synonyms: 9430078C22Rik, Gt4-2, Zfpip
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 242466
Homologene: 41430
Cep350
Name: centrosomal protein 350
Synonyms: 4933409L06Rik, 6430546F08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 74081
Homologene: 8879
Slitrk6
Name: SLIT and NTRK-like family, member 6
Synonyms: 4832410J21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 239250
VEGA: 14
Homologene: 12986
Sucla2
Name: succinate-Coenzyme A ligase, ADP-forming, beta subunit
Synonyms: 4930547K18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 20916
Homologene: 2856
Atp5h
Name: ATP synthase, H+ transporting, mitochondrial F0 complex, subunit D
Synonyms: 0610009D10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 71679
HGNC: HGNC:845
Homologene: 130552
Wdr62
Name: WD repeat domain 62
Synonyms: b2b1508Clo, 2310038K02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 233064
Homologene: 15927
Psmg1
Name: proteasome (prosome, macropain) assembly chaperone 1
Synonyms: Dscr2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 56088
HGNC: HGNC:3043
Homologene: 2759
Ahi1
Name: Abelson helper integration site 1
Synonyms: 1700015F03Rik, Ahi-1, Jouberin, D10Bwg0629e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 52906
VEGA: 10
Homologene: 9762
Fzd7
Name: frizzled class receptor 7
Synonyms: Fz7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 14369
HGNC: HGNC:4045
Homologene: 20751
Atoh1
Name: atonal bHLH transcription factor 1
Synonyms: bHLHa14, Math1, Hath1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 11921
HGNC: HGNC:797
Homologene: 31297
Dsp
Name: desmoplakin
Synonyms: 5730453H04Rik, DP, 2300002E22Rik, rul
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 109620
HGNC: HGNC:3052
Homologene: 37922
Rsbn1l
Name: round spermatid basic protein 1-like
Synonyms: C330002G24Rik, 8430412F05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 242860
Homologene: 19435
Alms1
Name: ALMS1, centrosome and basal body associated
Synonyms: Alstrom syndrome 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 236266
HGNC: HGNC:428
Homologene: 49406
Fbf1
Name: Fas (TNFRSF6) binding factor 1
Synonyms: 1110033G01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 217335
Homologene: 16531
Rreb1
Name: ras responsive element binding protein 1
Synonyms: 1110037N09Rik, B930013M22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 68750
Homologene: 2218
Arhgap33
Name: Rho GTPase activating protein 33
Synonyms: Snx26, Tcgap, NOMA-GAP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 233071
Homologene: 76448
Uimc1
Name: ubiquitin interaction motif containing 1
Synonyms: D630032M02Rik, 9430016E08Rik, D330018D10Rik, Rxrip110
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 20184
Homologene: 9455
Brca2
Name: breast cancer 2, early onset
Synonyms: Fancd1, RAB163
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 12190
HGNC: HGNC:1101
Homologene: 41
Akirin2
Name: akirin 2
Synonyms: 2700059D21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 433693
Homologene: 9988
Med23
Name: mediator complex subunit 23
Synonyms: ESTM7, X83317, 3000002A17Rik, Sur2, Crsp3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 70208
HGNC: HGNC:2372
Homologene: 3552
Arpc1a
Name: actin related protein 2/3 complex, subunit 1A
Synonyms: 0610010H08Rik, 1110030K07Rik, Sid32
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 56443
HGNC: HGNC:703
Homologene: 4675
Lbr
Name: lamin B receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 98386
HGNC: HGNC:6518
Homologene: 2455
Sf3b2
Name: splicing factor 3b, subunit 2
Synonyms: SF3b1, SF3b145, SAP145, B230398H18Rik, 2810441F20Rik, 2610311M13Rik, 145kDa, SF3b150
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 319322
VEGA: 19
Homologene: 6678
Gemin5
Name: gem nuclear organelle associated protein 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 216766
Homologene: 9155
Zfhx4
Name: zinc finger homeodomain 4
Synonyms: Zfh-4, C130041O22Rik, Zfh4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 80892
Homologene: 23477
Tns2
Name: tensin 2
Synonyms: nep, Tenc1, nph
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 209039
VEGA: 15
Homologene: 37077
Myo16
Name: myosin XVI
Synonyms: BM140241, C230040D10Rik, Nyap3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 244281
Homologene: 34710
Muc6
Name: mucin 6, gastric
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 353328
HGNC: HGNC:7517
Homologene: 18768
Myo1g
Name: myosin IG
Synonyms: E430002D17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 246177
Homologene: 27996
Ctdspl
Name: CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like
Synonyms: SCP3, HYA22, 2810418J22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 69274
Homologene: 48881
Ankrd52
Name: ankyrin repeat domain 52
Synonyms: G431002C21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 237615
Homologene: 18227
Dock10
Name: dedicator of cytokinesis 10
Synonyms: Zizimin3, Jr4, Jr5, A630054M16Rik, 9330153B10Rik, ZIZ3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 210293
Homologene: 45952
Ces2g
Name: carboxylesterase 2G
Synonyms: 2210023G05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 72361
HGNC: HGNC:1864
Homologene: 77154
Csmd3
Name: CUB and Sushi multiple domains 3
Synonyms: 4930500N14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 239420
Homologene: 65982
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: E130113P14Rik, bl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 231470
Homologene: 23516
Parp3
Name: poly (ADP-ribose) polymerase family, member 3
Synonyms: Adprt3, A930002C11Rik, Adprtl3, PARP-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 235587
HGNC: HGNC:273
Homologene: 4005
Gm11232
Name: predicted gene 11232
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 102634852
Pdk2
Name: pyruvate dehydrogenase kinase, isoenzyme 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 18604
HGNC: HGNC:8810
Homologene: 68265
Stkld1
Name: serine/threonine kinase-like domain containing 1
Synonyms: LOC279029, Gm711
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 279029
Homologene: 19586
Mroh3
Name: maestro heat-like repeat family member 3
Synonyms: 2310006M14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 76422
Mrpl37
Name: mitochondrial ribosomal protein L37
Synonyms: 2300004O14Rik, MRP-L2, Rpml2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 56280
Homologene: 9536
CAAA01180111.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
Postn
Name: periostin, osteoblast specific factor
Synonyms: Osf2, OSF-2, Periostin, A630052E07Rik, peri
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 50706
Homologene: 4730
Pkd1l2
Name: polycystic kidney disease 1 like 2
Synonyms: 1700126L06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 76645
Homologene: 124481
Sh2b1
Name: SH2B adaptor protein 1
Synonyms: SH2-B, Irip, SH2-Bb, Sh2bpsm1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 20399
Homologene: 32122
Gm5828
Name: predicted gene 5828
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 545306
Disp3
Name: dispatched RND transporter family member 3
Synonyms: Ptchd2, G630052C06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 242748
Homologene: 25712
Tmem67
Name: transmembrane protein 67
Synonyms: 5330408M12Rik, b2b1163.1Clo, b2b1291.1Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 329795
Homologene: 71886
Krt8
Name: keratin 8
Synonyms: Card2, EndoA, cytokeratin 8, cytokeratin8, K8, Krt-2.8, cytokeratin-8, Krt2-8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 16691
VEGA: 15
HGNC: HGNC:6446
Homologene: 55643
Cdh15
Name: cadherin 15
Synonyms: Mcad, Cdh14, M cadherin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 12555
HGNC: HGNC:1754
Homologene: 3622
Gpr180
Name: G protein-coupled receptor 180
Synonyms: E130016I23Rik, ITR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 58245
VEGA: 14
Homologene: 32506
Fam149b
Name: family with sequence similarity 149, member B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 105428
VEGA: 14
Homologene: 67023
Kcnq3
Name: potassium voltage-gated channel, subfamily Q, member 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 110862
HGNC: HGNC:6297
Homologene: 20949
Parp8
Name: poly (ADP-ribose) polymerase family, member 8
Synonyms: D13Ertd275e, 2810430O08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 52552
VEGA: 13
Homologene: 11621
Baiap2l2
Name: BAI1-associated protein 2-like 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 207495
Homologene: 11811
Sec61a2
Name: Sec61, alpha subunit 2 (S. cerevisiae)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 57743
Homologene: 38481
Slc34a3
Name: solute carrier family 34 (sodium phosphate), member 3
Synonyms: NPTIIc, Npt2c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 142681
Homologene: 15444
H2-M11
Name: histocompatibility 2, M region locus 11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 224754
Homologene: 52241
Fastkd5
Name: FAST kinase domains 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 380601
Homologene: 36400
G6pd2
Name: glucose-6-phosphate dehydrogenase 2
Synonyms: G6pdx-ps1, Gpd2, Gpd-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 14380
Mgat5
Name: mannoside acetylglucosaminyltransferase 5
Synonyms: 5330407H02Rik, 4930471A21Rik, beta1,6N-acetylglucosaminyltransferase V, GlcNAc-TV
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 107895
HGNC: HGNC:7049
Homologene: 1808
Phf1
Name: PHD finger protein 1
Synonyms: D17Ertd455e, mPcl1, PHF2, Tctex-3, Tctex3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 21652
VEGA: 17
HGNC: HGNC:8919
Homologene: 7567
Celf3
Name: CUGBP, Elav-like family member 3
Synonyms: 4930415M08Rik, ERDA4, Tnrc4, CAGH4, BRUNOL1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 78784
Homologene: 48510
Cyp2d34
Name: cytochrome P450, family 2, subfamily d, polypeptide 34
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 223706
VEGA: 15
Homologene: 86099
Olfr610
Name: olfactory receptor 610
Synonyms: MOR9-2, GA_x6K02T2PBJ9-6221839-6220892
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 259085
Homologene: 17495
Ldc1
Name: leucine decarboxylase 1
Synonyms: Gm853, LOC332942
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 332942
Homologene: 128653
Gm15737
Name: predicted gene 15737
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
Olfr815
Name: olfactory receptor 815
Synonyms: GA_x6K02T2PULF-11581263-11580331, MOR113-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 258665
Krtap4-9
Name: keratin associated protein 4-9
Synonyms: OTTMUSG00000002198
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 665998
Jakmip3
Name: janus kinase and microtubule interacting protein 3
Synonyms: 6330417G02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 74004
Homologene: 90425
Entpd2
Name: ectonucleoside triphosphate diphosphohydrolase 2
Synonyms: Cd39l1, NTPDase2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 12496
HGNC: HGNC:3364
Homologene: 20333
Gimap4
Name: GTPase, IMAP family member 4
Synonyms: Ian1, E430007K16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 107526
Homologene: 75084
Efhd1
Name: EF hand domain containing 1
Synonyms: mitocalcin, 4931430I01Rik, PP3051
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 98363
Homologene: 41618
Cd8b1
Name: CD8 antigen, beta chain 1
Synonyms: Lyt-3, Ly-3, Ly-C
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 12526
HGNC: HGNC:1707
Homologene: 3621
Ube2d4
Name: ubiquitin-conjugating enzyme E2D 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
Rab11b
Name: RAB11B, member RAS oncogene family
Synonyms: A730055L17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 19326
HGNC: HGNC:9761
Homologene: 68691
Mlf1
Name: myeloid leukemia factor 1
Synonyms: HLS7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 17349
HGNC: HGNC:7125
Homologene: 7839
Ramp2
Name: receptor (calcitonin) activity modifying protein 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 54409
HGNC: HGNC:9844
Homologene: 4274
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 16,769,394 bp
  • C to A, chromosome 1 at 59,484,536 bp
  • G to T, chromosome 1 at 71,568,971 bp
  • T to A, chromosome 1 at 80,540,253 bp
  • A to T, chromosome 1 at 87,309,755 bp
  • A to T, chromosome 1 at 127,307,004 bp
  • A to C, chromosome 1 at 136,198,126 bp
  • A to T, chromosome 1 at 155,959,718 bp
  • G to T, chromosome 1 at 181,836,127 bp
  • G to T, chromosome 2 at 5,882,693 bp
  • T to A, chromosome 2 at 25,231,515 bp
  • T to A, chromosome 2 at 25,399,283 bp
  • T to A, chromosome 2 at 26,950,638 bp
  • T to C, chromosome 2 at 130,616,365 bp
  • T to C, chromosome 3 at 5,245,143 bp
  • T to C, chromosome 3 at 9,609,493 bp
  • T to A, chromosome 3 at 54,376,953 bp
  • A to T, chromosome 3 at 67,384,586 bp
  • ACAGCAGCAGCAGCAGCAGCAGCA to ACAGCAGCAGCAGCAGCAGCA, chromosome 3 at 94,488,230 bp
  • T to A, chromosome 4 at 12,079,918 bp
  • T to C, chromosome 4 at 34,551,281 bp
  • T to A, chromosome 4 at 55,008,522 bp
  • C to A, chromosome 4 at 71,757,785 bp
  • T to A, chromosome 4 at 107,064,493 bp
  • A to T, chromosome 4 at 130,209,888 bp
  • T to A, chromosome 4 at 148,241,423 bp
  • T to A, chromosome 5 at 20,919,769 bp
  • ACTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT to ACTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT, chromosome 5 at 29,637,586 bp
  • T to A, chromosome 5 at 61,808,987 bp
  • T to C, chromosome 5 at 96,741,048 bp
  • T to C, chromosome 5 at 145,097,333 bp
  • A to T, chromosome 5 at 150,541,762 bp
  • C to T, chromosome 6 at 48,690,865 bp
  • T to A, chromosome 6 at 55,065,563 bp
  • T to A, chromosome 6 at 64,729,684 bp
  • T to C, chromosome 6 at 71,334,084 bp
  • T to A, chromosome 6 at 85,622,482 bp
  • T to A, chromosome 6 at 92,879,720 bp
  • A to T, chromosome 7 at 30,273,999 bp
  • C to A, chromosome 7 at 30,527,229 bp
  • A to G, chromosome 7 at 103,506,160 bp
  • C to T, chromosome 7 at 126,468,926 bp
  • A to T, chromosome 7 at 138,989,468 bp
  • A to G, chromosome 7 at 141,640,384 bp
  • A to T, chromosome 8 at 10,594,820 bp
  • T to C, chromosome 8 at 104,965,989 bp
  • T to C, chromosome 8 at 117,019,494 bp
  • G to A, chromosome 8 at 122,862,024 bp
  • T to C, chromosome 9 at 106,475,154 bp
  • T to A, chromosome 9 at 106,703,626 bp
  • A to G, chromosome 9 at 107,791,998 bp
  • G to A, chromosome 9 at 119,040,513 bp
  • T to C, chromosome 9 at 124,293,071 bp
  • T to A, chromosome 9 at 124,293,153 bp
  • T to A, chromosome 10 at 20,970,911 bp
  • A to G, chromosome 10 at 24,888,575 bp
  • T to C, chromosome 10 at 128,313,897 bp
  • G to T, chromosome 10 at 128,389,351 bp
  • A to C, chromosome 10 at 129,902,095 bp
  • T to A, chromosome 11 at 6,512,539 bp
  • A to T, chromosome 11 at 58,122,272 bp
  • A to G, chromosome 11 at 95,027,202 bp
  • T to A, chromosome 11 at 99,785,666 bp
  • TTGCTGCTGCTGCTGCTGCTGCTG to TTGCTGCTGCTGCTGCTGCTG, chromosome 11 at 101,246,545 bp
  • T to A, chromosome 11 at 115,416,038 bp
  • C to G, chromosome 11 at 116,148,806 bp
  • G to T, chromosome 13 at 37,929,792 bp
  • A to T, chromosome 13 at 38,196,404 bp
  • G to T, chromosome 13 at 55,075,804 bp
  • T to A, chromosome 13 at 99,400,328 bp
  • A to G, chromosome 13 at 116,895,687 bp
  • A to T, chromosome 14 at 20,375,510 bp
  • A to T, chromosome 14 at 21,003,091 bp
  • A to T, chromosome 14 at 54,983,242 bp
  • A to T, chromosome 14 at 73,552,804 bp
  • T to C, chromosome 14 at 110,750,272 bp
  • T to C, chromosome 14 at 118,139,773 bp
  • CCTTTGCGCTT to CCTT, chromosome 15 at 47,741,236 bp
  • A to T, chromosome 15 at 58,846,679 bp
  • T to C, chromosome 15 at 66,031,427 bp
  • A to T, chromosome 15 at 79,261,974 bp
  • A to G, chromosome 15 at 82,616,167 bp
  • A to G, chromosome 15 at 101,998,024 bp
  • C to T, chromosome 15 at 102,108,934 bp
  • A to T, chromosome 16 at 95,982,195 bp
  • T to C, chromosome 17 at 26,937,088 bp
  • T to A, chromosome 17 at 33,747,718 bp
  • C to T, chromosome 17 at 36,548,150 bp
  • A to T, chromosome 19 at 5,275,090 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2566 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
040425-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.