Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2566Btlr/Mmmh
Stock Number:
040425-MU
Citation ID:
RRID:MMRRC_040425-MU
Other Names:
R2566 (G1), C57BL/6J-MtgxR2566Btlr
Major Collection:

Strain Information

Myh7
Name: myosin, heavy polypeptide 7, cardiac muscle, beta
Synonyms: Myhc-b, Myhcb, beta-MHC, B-MHC, MYH-beta/slow, MyHC-I, betaMHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 140781
HGNC: HGNC:7577
Homologene: 68044
Atic
Name: 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase
Synonyms: 2610509C24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108147
HGNC: HGNC:794
Homologene: 2983
Rad54l2
Name: RAD54 like 2 (S. cerevisiae)
Synonyms: Arip4, G630026H09Rik, Srisnf2l
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 81000
Homologene: 56698
Zfp704
Name: zinc finger protein 704
Synonyms: Gig1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 170753
Homologene: 64370
Rbm6
Name: RNA binding motif protein 6
Synonyms: NY-LU-12, g16, Def-3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19654
HGNC: HGNC:9903
Homologene: 31336
Ube3c
Name: ubiquitin protein ligase E3C
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100763
Homologene: 8783
Gars1
Name: glycyl-tRNA synthetase 1
Synonyms: Sgrp23, GENA202, Gena201, Gars
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 353172
HGNC: HGNC:4162
Homologene: 1547
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 16,769,394 bp
  • C to A, chromosome 1 at 59,484,536 bp
  • G to T, chromosome 1 at 71,568,971 bp
  • T to A, chromosome 1 at 80,540,253 bp
  • A to T, chromosome 1 at 87,309,755 bp
  • A to T, chromosome 1 at 127,307,004 bp
  • A to C, chromosome 1 at 136,198,126 bp
  • A to T, chromosome 1 at 155,959,718 bp
  • G to T, chromosome 1 at 181,836,127 bp
  • G to T, chromosome 2 at 5,882,693 bp
  • T to A, chromosome 2 at 25,231,515 bp
  • T to A, chromosome 2 at 25,399,283 bp
  • T to A, chromosome 2 at 26,950,638 bp
  • T to C, chromosome 2 at 130,616,365 bp
  • T to C, chromosome 3 at 5,245,143 bp
  • T to C, chromosome 3 at 9,609,493 bp
  • T to A, chromosome 3 at 54,376,953 bp
  • A to T, chromosome 3 at 67,384,586 bp
  • ACAGCAGCAGCAGCAGCAGCAGCA to ACAGCAGCAGCAGCAGCAGCA, chromosome 3 at 94,488,230 bp
  • T to A, chromosome 4 at 12,079,918 bp
  • T to C, chromosome 4 at 34,551,281 bp
  • T to A, chromosome 4 at 55,008,522 bp
  • C to A, chromosome 4 at 71,757,785 bp
  • T to A, chromosome 4 at 107,064,493 bp
  • A to T, chromosome 4 at 130,209,888 bp
  • T to A, chromosome 4 at 148,241,423 bp
  • T to A, chromosome 5 at 20,919,769 bp
  • ACTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT to ACTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT, chromosome 5 at 29,637,586 bp
  • T to A, chromosome 5 at 61,808,987 bp
  • T to C, chromosome 5 at 96,741,048 bp
  • T to C, chromosome 5 at 145,097,333 bp
  • A to T, chromosome 5 at 150,541,762 bp
  • C to T, chromosome 6 at 48,690,865 bp
  • T to A, chromosome 6 at 55,065,563 bp
  • T to A, chromosome 6 at 64,729,684 bp
  • T to C, chromosome 6 at 71,334,084 bp
  • T to A, chromosome 6 at 85,622,482 bp
  • T to A, chromosome 6 at 92,879,720 bp
  • A to T, chromosome 7 at 30,273,999 bp
  • C to A, chromosome 7 at 30,527,229 bp
  • A to G, chromosome 7 at 103,506,160 bp
  • C to T, chromosome 7 at 126,468,926 bp
  • A to T, chromosome 7 at 138,989,468 bp
  • A to G, chromosome 7 at 141,640,384 bp
  • A to T, chromosome 8 at 10,594,820 bp
  • T to C, chromosome 8 at 104,965,989 bp
  • T to C, chromosome 8 at 117,019,494 bp
  • G to A, chromosome 8 at 122,862,024 bp
  • T to C, chromosome 9 at 106,475,154 bp
  • T to A, chromosome 9 at 106,703,626 bp
  • A to G, chromosome 9 at 107,791,998 bp
  • G to A, chromosome 9 at 119,040,513 bp
  • T to C, chromosome 9 at 124,293,071 bp
  • T to A, chromosome 9 at 124,293,153 bp
  • T to A, chromosome 10 at 20,970,911 bp
  • A to G, chromosome 10 at 24,888,575 bp
  • T to C, chromosome 10 at 128,313,897 bp
  • G to T, chromosome 10 at 128,389,351 bp
  • A to C, chromosome 10 at 129,902,095 bp
  • T to A, chromosome 11 at 6,512,539 bp
  • A to T, chromosome 11 at 58,122,272 bp
  • A to G, chromosome 11 at 95,027,202 bp
  • T to A, chromosome 11 at 99,785,666 bp
  • TTGCTGCTGCTGCTGCTGCTGCTG to TTGCTGCTGCTGCTGCTGCTG, chromosome 11 at 101,246,545 bp
  • T to A, chromosome 11 at 115,416,038 bp
  • C to G, chromosome 11 at 116,148,806 bp
  • G to T, chromosome 13 at 37,929,792 bp
  • A to T, chromosome 13 at 38,196,404 bp
  • G to T, chromosome 13 at 55,075,804 bp
  • T to A, chromosome 13 at 99,400,328 bp
  • A to G, chromosome 13 at 116,895,687 bp
  • A to T, chromosome 14 at 20,375,510 bp
  • A to T, chromosome 14 at 21,003,091 bp
  • A to T, chromosome 14 at 54,983,242 bp
  • A to T, chromosome 14 at 73,552,804 bp
  • T to C, chromosome 14 at 110,750,272 bp
  • T to C, chromosome 14 at 118,139,773 bp
  • CCTTTGCGCTT to CCTT, chromosome 15 at 47,741,236 bp
  • A to T, chromosome 15 at 58,846,679 bp
  • T to C, chromosome 15 at 66,031,427 bp
  • A to T, chromosome 15 at 79,261,974 bp
  • A to G, chromosome 15 at 82,616,167 bp
  • A to G, chromosome 15 at 101,998,024 bp
  • C to T, chromosome 15 at 102,108,934 bp
  • A to T, chromosome 16 at 95,982,195 bp
  • T to C, chromosome 17 at 26,937,088 bp
  • T to A, chromosome 17 at 33,747,718 bp
  • C to T, chromosome 17 at 36,548,150 bp
  • A to T, chromosome 19 at 5,275,090 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2566 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040425-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.