Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2911Btlr/Mmmh
Stock Number:
040498-MU
Citation ID:
RRID:MMRRC_040498-MU
Other Names:
R2911 (G1), C57BL/6J-MtgxR2911Btlr
Major Collection:

Strain Information

Uso1
Name: USO1 vesicle docking factor
Synonyms: transcytosis associated protein p115, TAP, Vdp
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56041
Homologene: 2754
Snx2
Name: sorting nexin 2
Synonyms: 0610030A03Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67804
VEGA: 18
Homologene: 2332
Mbtps1
Name: membrane-bound transcription factor peptidase, site 1
Synonyms: subtilisin/kexin isozyme-1, SKI-1, S1P, 0610038M03Rik, site-1 protease
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56453
Homologene: 2808
Odf2l
Name: outer dense fiber of sperm tails 2-like
Synonyms: 4733401D09Rik, 9630045K08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 52184
Homologene: 12011
Dclre1c
Name: DNA cross-link repair 1C
Synonyms: 9930121L06Rik, Artemis, Art
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227525
Homologene: 32547
Fryl
Name: FRY like transcription coactivator
Synonyms: 2310004H21Rik, 2510002A14Rik, 9030227G01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72313
Homologene: 103956
Rgs3
Name: regulator of G-protein signaling 3
Synonyms: 4930506N09Rik, C2pa, PDZ-RGS3, RGS3S, C2PA-RGS3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 50780
HGNC: HGNC:9999
Homologene: 32440
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 4,493,131 bp
  • A to T, chromosome 1 at 53,427,824 bp
  • A to G, chromosome 1 at 130,849,533 bp
  • C to A, chromosome 1 at 153,428,626 bp
  • G to A, chromosome 1 at 175,785,615 bp
  • G to T, chromosome 1 at 183,096,344 bp
  • C to T, chromosome 2 at 3,438,107 bp
  • A to T, chromosome 2 at 24,607,541 bp
  • T to C, chromosome 2 at 41,506,692 bp
  • T to C, chromosome 2 at 129,101,274 bp
  • T to C, chromosome 2 at 156,353,190 bp
  • T to C, chromosome 2 at 157,469,384 bp
  • A to G, chromosome 3 at 142,506,701 bp
  • A to C, chromosome 3 at 145,124,323 bp
  • C to A, chromosome 4 at 3,585,616 bp
  • C to T, chromosome 4 at 62,697,344 bp
  • A to T, chromosome 4 at 115,433,526 bp
  • T to C, chromosome 4 at 135,559,146 bp
  • A to G, chromosome 4 at 141,103,082 bp
  • T to A, chromosome 4 at 153,995,427 bp
  • A to G, chromosome 5 at 62,621,979 bp
  • A to T, chromosome 5 at 63,794,345 bp
  • T to C, chromosome 5 at 73,050,456 bp
  • T to C, chromosome 5 at 86,816,559 bp
  • T to C, chromosome 5 at 92,194,181 bp
  • T to C, chromosome 5 at 121,350,643 bp
  • A to G, chromosome 6 at 7,559,097 bp
  • T to A, chromosome 6 at 116,698,331 bp
  • A to G, chromosome 8 at 119,546,037 bp
  • A to T, chromosome 8 at 122,908,798 bp
  • A to G, chromosome 9 at 20,300,479 bp
  • T to C, chromosome 9 at 39,550,821 bp
  • C to T, chromosome 9 at 70,718,723 bp
  • CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 9 at 78,712,500 bp
  • A to G, chromosome 9 at 97,532,722 bp
  • T to C, chromosome 9 at 99,655,602 bp
  • G to A, chromosome 11 at 34,068,970 bp
  • A to G, chromosome 11 at 34,232,910 bp
  • G to A, chromosome 11 at 58,608,426 bp
  • A to G, chromosome 11 at 69,887,076 bp
  • A to G, chromosome 11 at 119,325,563 bp
  • C to T, chromosome 12 at 13,231,440 bp
  • T to G, chromosome 12 at 102,373,584 bp
  • A to T, chromosome 13 at 37,948,920 bp
  • A to T, chromosome 14 at 59,387,403 bp
  • C to T, chromosome 14 at 75,040,808 bp
  • T to A, chromosome 15 at 28,436,157 bp
  • A to G, chromosome 16 at 20,560,232 bp
  • C to T, chromosome 16 at 59,110,181 bp
  • A to C, chromosome 16 at 63,652,412 bp
  • T to A, chromosome 17 at 20,564,529 bp
  • A to T, chromosome 17 at 71,500,376 bp
  • T to C, chromosome 18 at 34,845,690 bp
  • T to C, chromosome 18 at 36,676,185 bp
  • C to T, chromosome 18 at 53,199,874 bp
  • T to C, chromosome 18 at 62,519,807 bp
  • A to G, chromosome 19 at 9,011,654 bp
  • T to C, chromosome 19 at 10,443,435 bp
  • T to A, chromosome 19 at 33,579,367 bp
  • T to G, chromosome 19 at 39,087,682 bp
  • A to C, chromosome X at 108,664,765 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2911 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040498-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.