Strain Name:
C57BL/6J-MtgxR4158Btlr/Mmmh
Stock Number:
041001-MU
Citation ID:
RRID:MMRRC_041001-MU
Other Names:
R4158 (G1), C57BL/6J-MtgxR4158Btlr
Major Collection:

Gene Information

Ptprz1
Name: protein tyrosine phosphatase, receptor type Z, polypeptide 1
Synonyms: RPTPz, PTPzeta, Ptprz, Ptpz, DSD-1-PG, Rptpbeta, phosphacan, PTPbeta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 19283
HGNC: HGNC:9685
Homologene: 2136
Eomes
Name: eomesodermin
Synonyms: Tbr2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 13813
HGNC: HGNC:3372
Homologene: 3971
Cyp19a1
Name: cytochrome P450, family 19, subfamily a, polypeptide 1
Synonyms: p450arom, Ar, Cyp19, Int5, Int-5, ArKO, aromatase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 13075
VEGA: 9
HGNC: HGNC:2594
Homologene: 30955
Ppp6r3
Name: protein phosphatase 6, regulatory subunit 3
Synonyms: D19Ertd703e, Saps3, Pptcs3, Pp6r3, 9130026N02Rik, D19Bwg1430e, 4930528G08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 52036
VEGA: 19
HGNC: HGNC:1173
Homologene: 115911
Fbxl20
Name: F-box and leucine-rich repeat protein 20
Synonyms: Scr, Fbl2, 4632423N09Rik, C86145, 2610511F20Rik, Scrapper
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 72194
Homologene: 68784
Cep350
Name: centrosomal protein 350
Synonyms: 6430546F08Rik, 4933409L06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 74081
Homologene: 8879
Zfp981
Name: zinc finger protein 981
Synonyms: Gm13247
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 100041433
Homologene: 133076
Magi3
Name: membrane associated guanylate kinase, WW and PDZ domain containing 3
Synonyms: 4732496O19Rik, 6530407C02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 99470
Homologene: 26431
Flcn
Name: folliculin
Synonyms: B430214A04Rik, BHD
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216805
Homologene: 14583
Dse
Name: dermatan sulfate epimerase
Synonyms: B130024B19Rik, Sart2, DS-epi1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 212898
VEGA: 10
Homologene: 8354
Dnajc13
Name: DnaJ heat shock protein family (Hsp40) member C13
Synonyms: LOC382100, Rme8, D030002L11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235567
Homologene: 13574
Sec31b
Name: Sec31 homolog B (S. cerevisiae)
Synonyms: LOC240667, Sec31l2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 240667
Homologene: 56708
Adgrf4
Name: adhesion G protein-coupled receptor F4
Synonyms: 4632435A09Rik, Gpr115
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 78249
Homologene: 51953
Mocos
Name: molybdenum cofactor sulfurase
Synonyms: 1110018O12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 68591
VEGA: 18
Homologene: 9931
Ush2a
Name: usherin
Synonyms: MUSH2A, LOC381317, Ushrn, A930011D15Rik, LOC269160, A930037M10Rik, Ush2a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 22283
Homologene: 66151
Adam34
Name: a disintegrin and metallopeptidase domain 34
Synonyms: testase 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 252866
Homologene: 78104
Bsn
Name: bassoon
Synonyms: presynaptic cytomatrix protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 12217
HGNC: HGNC:1117
Homologene: 31161
Ikzf4
Name: IKAROS family zinc finger 4
Synonyms: Zfpn1a4, A630026H08Rik, Eos
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 22781
Homologene: 69103
Pla2r1
Name: phospholipase A2 receptor 1
Synonyms: Pla2g1br, PLA2-I receptor, M-type receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18779
HGNC: HGNC:9042
Homologene: 32016
Efcab14
Name: EF-hand calcium binding domain 14
Synonyms: 4732418C07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230648
Homologene: 8858
Tex14
Name: testis expressed gene 14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 83560
Homologene: 12838
Ankrd1
Name: ankyrin repeat domain 1 (cardiac muscle)
Synonyms: MARP1, Alrp, CARP, Crap
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 107765
VEGA: 19
Homologene: 8289
Sdk1
Name: sidekick cell adhesion molecule 1
Synonyms: 6720466O15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 330222
Homologene: 27395
Slc26a7
Name: solute carrier family 26, member 7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 208890
Homologene: 13770
Arg1
Name: arginase, liver
Synonyms: PGIF, Arg-1, AI
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 11846
VEGA: 10
HGNC: HGNC:663
Homologene: 29
Arhgef19
Name: Rho guanine nucleotide exchange factor (GEF) 19
Synonyms: WGEF, 6430573B13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 213649
Homologene: 17710
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: ELK1, C130090D05Rik, Kv12.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 211468
Homologene: 14332
Iltifb
Name: interleukin 10-related T cell-derived inducible factor beta
Synonyms: Il22b, IL-TIFb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 116849
Homologene: 9669
Hint2
Name: histidine triad nucleotide binding protein 2
Synonyms: 1190005L05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 68917
Homologene: 13072
Nox4
Name: NADPH oxidase 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 50490
HGNC: HGNC:7891
Homologene: 41065
Lrrc45
Name: leucine rich repeat containing 45
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217366
Homologene: 17019
Vat1l
Name: vesicle amine transport protein 1 like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 270097
Homologene: 10855
Oasl1
Name: 2'-5' oligoadenylate synthetase-like 1
Synonyms: 7530414C13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231655
HGNC: HGNC:8090
Homologene: 2769
Kcne4
Name: potassium voltage-gated channel, Isk-related subfamily, gene 4
Synonyms: MiRP3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 57814
HGNC: HGNC:6244
Homologene: 10959
Gm20939
Name: predicted gene, 20939
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 100044193
VEGA: 17
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 78,818,102 bp
  • G to A, chromosome 1 at 155,932,875 bp
  • G to A, chromosome 1 at 188,728,710 bp
  • A to T, chromosome 2 at 60,422,622 bp
  • T to C, chromosome 3 at 104,050,961 bp
  • T to C, chromosome 4 at 14,544,197 bp
  • T to G, chromosome 4 at 43,654,616 bp
  • A to C, chromosome 4 at 115,740,397 bp
  • T to C, chromosome 4 at 141,246,349 bp
  • C to A, chromosome 4 at 146,537,623 bp
  • T to A, chromosome 4 at 146,537,882 bp
  • A to G, chromosome 5 at 114,937,014 bp
  • A to G, chromosome 5 at 142,114,399 bp
  • A to T, chromosome 6 at 23,001,684 bp
  • T to C, chromosome 6 at 23,022,205 bp
  • A to T, chromosome 7 at 87,396,824 bp
  • T to C, chromosome 8 at 43,650,817 bp
  • T to A, chromosome 8 at 114,371,729 bp
  • G to A, chromosome 9 at 54,186,696 bp
  • G to A, chromosome 9 at 104,190,442 bp
  • A to G, chromosome 9 at 108,112,946 bp
  • A to G, chromosome 9 at 118,478,963 bp
  • T to C, chromosome 10 at 24,922,677 bp
  • A to G, chromosome 10 at 34,153,334 bp
  • T to C, chromosome 10 at 118,293,132 bp
  • A to T, chromosome 10 at 128,643,736 bp
  • T to C, chromosome 11 at 59,801,121 bp
  • T to G, chromosome 11 at 87,516,769 bp
  • T to C, chromosome 11 at 98,095,394 bp
  • A to T, chromosome 11 at 120,718,446 bp
  • G to T, chromosome 17 at 42,667,677 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • A to T, chromosome 17 at 94,876,734 bp
  • T to C, chromosome 18 at 24,674,246 bp
  • T to A, chromosome 19 at 3,512,037 bp
  • T to A, chromosome 19 at 36,117,873 bp
  • T to C, chromosome 19 at 44,525,186 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4158 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
041001-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.