Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4274Btlr/Mmmh
Stock Number:
041077-MU
Citation ID:
RRID:MMRRC_041077-MU
Other Names:
R4274 (G1), C57BL/6J-MtgxR4274Btlr
Major Collection:

Strain Information

Tnpo1
Name: transportin 1
Synonyms: D13Ertd688e, Kpnb2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238799
HGNC: HGNC:6401
Homologene: 5358
Tlr6
Name: toll-like receptor 6
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 21899
Homologene: 21223
Dnajc17
Name: DnaJ heat shock protein family (Hsp40) member C17
Synonyms: D9Bwg1371e, 1700025B16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69408
Homologene: 49527
Acap2
Name: ArfGAP with coiled-coil, ankyrin repeat and PH domains 2
Synonyms: 9530039J15Rik, Centb2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78618
VEGA: 16
Homologene: 8182
Dot1l
Name: DOT1 like histone lysine methyltransferase
Synonyms: mDot1, KMT4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 208266
Homologene: 32779
Dhx9
Name: DExH-box helicase 9
Synonyms: leukophysin, nuclear DNA helicase II, RNA helicase, Ddx9, NDH II, NDHII, RHA
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13211
HGNC: HGNC:2750
Homologene: 1039
Prpf40a
Name: pre-mRNA processing factor 40A
Synonyms: FBP11, 2810012K09Rik, Fnbp3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56194
Homologene: 6377
Abcc4
Name: ATP-binding cassette, sub-family C member 4
Synonyms: D630049P08Rik, MOAT-B, MRP4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239273
VEGA: 14
HGNC: HGNC:55
Homologene: 74563
Atp13a1
Name: ATPase type 13A1
Synonyms: catp, Cgi152, Atp13a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 170759
VEGA: 8
Homologene: 5791
Fcho1
Name: FCH domain only 1
Synonyms: 3322402E17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74015
Homologene: 22869
Mei1
Name: meiotic double-stranded break formation protein 1
Synonyms: mei1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 74369
Homologene: 46535
Ostm1
Name: osteopetrosis associated transmembrane protein 1
Synonyms: gl, 1200002H13Rik, HSPC019
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14628
Homologene: 32203
Hspg2
Name: perlecan (heparan sulfate proteoglycan 2)
Synonyms: per, Pcn, Plc, perlecan
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 15530
HGNC: HGNC:5273
Homologene: 68473
Zscan22
Name: zinc finger and SCAN domain containing 22
Synonyms: D530006B18Rik, Hkr2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232878
HGNC: HGNC:4929
Homologene: 68122
Zcchc7
Name: zinc finger, CCHC domain containing 7
Synonyms: 4930572I07Rik, D4Wsu132e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 319885
Homologene: 22217
Kcnq1
Name: potassium voltage-gated channel, subfamily Q, member 1
Synonyms: KVLQT1, Kcna9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16535
HGNC: HGNC:6294
Homologene: 85014
Rpgrip1l
Name: Rpgrip1-like
Synonyms: Ftm, 1700047E16Rik, fantom, Nphp8
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244585
Homologene: 18296
Adamts6
Name: ADAM metallopeptidase with thrombospondin type 1 motif 6
Synonyms: ADAM-TS6, A930019D11Rik, b2b2228Clo, b2b2187.1Clo, b2b2182Clo, b2b2029Clo, b2b1879.1Clo
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 108154
VEGA: 13
HGNC: HGNC:222
Homologene: 82573
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Siglec1
Name: sialic acid binding Ig-like lectin 1, sialoadhesin
Synonyms: CD169, Siglec-1, Sn
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20612
Homologene: 124458
Fer1l4
Name: fer-1 like family member 4
Synonyms: 9130402C12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74562
Homologene: 19075
Me3
Name: malic enzyme 3, NADP(+)-dependent, mitochondrial
Synonyms: B230207H15Rik, 1700020C08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 109264
HGNC: HGNC:6985
Homologene: 100773
Msto1
Name: misato 1, mitochondrial distribution and morphology regulator
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229524
Homologene: 41228
Htra1
Name: HtrA serine peptidase 1
Synonyms: insulin-like growth factor binding protein 5 protease, RSPP11, L56, HtrA1, Prss11
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56213
HGNC: HGNC:9476
Homologene: 31114
Ugt2a3
Name: UDP glucuronosyltransferase 2 family, polypeptide A3
Synonyms: 2010321J07Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72094
Homologene: 55988
Or4k37
Name: olfactory receptor family 4 subfamily K member 37
Synonyms: GA_x6K02T2Q125-72379864-72380781, MOR248-18, MOR248-14P, Olfr1281
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257979
Homologene: 73992
Ednra
Name: endothelin receptor type A
Synonyms: ETa, ET-AR, Gpcr10, AEA001, Mhdaaea1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13617
HGNC: HGNC:3179
Homologene: 1478
Abca8a
Name: ATP-binding cassette, sub-family A member 8a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217258
HGNC: HGNC:38
Homologene: 131160
Fetub
Name: fetuin beta
Synonyms: 2310011O17Rik, D17980
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 59083
VEGA: 16
HGNC: HGNC:3658
Homologene: 8660
Rtn2
Name: reticulon 2 (Z-band associated protein)
Synonyms: Nspl1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20167
Homologene: 32180
Glis3
Name: GLIS family zinc finger 3
Synonyms: E330013K21Rik, 4833409N03Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226075
Homologene: 34989
Tns1
Name: tensin 1
Synonyms: 1200014E20Rik, E030018G17Rik, 1110018I21Rik, Tns, E030037J05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21961
Homologene: 11219
Ano9
Name: anoctamin 9
Synonyms: 5430425C04Rik, Tp53i5, Trp53i5, Tmem16j
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71345
Homologene: 67083
Foxc2
Name: forkhead box C2
Synonyms: MFH-1, Mfh1, Hfhbf3, Fkh14
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14234
HGNC: HGNC:3801
Homologene: 21091
Mrc2
Name: mannose receptor, C type 2
Synonyms: novel lectin, Endo180, uPARAP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17534
Homologene: 4408
Ano8
Name: anoctamin 8
Synonyms: Tmem16h
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382014
Homologene: 124473
Xkr5
Name: X-linked Kx blood group related 5
Synonyms: 5430438H03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 319581
Homologene: 52219
Fam83g
Name: family with sequence similarity 83, member G
Synonyms: 2310040C09Rik, wly
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69640
Homologene: 85169
Zfp82
Name: zinc finger protein 82
Synonyms: KRAB16
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330502
Homologene: 51177
Gpank1
Name: G patch domain and ankyrin repeats 1
Synonyms: G5, D17H6S54E, Bat4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 81845
Homologene: 13035
Card10
Name: caspase recruitment domain family, member 10
Synonyms: CARMA3, Bimp1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105844
Homologene: 8728
Dph7
Name: diphthamine biosynethesis 7
Synonyms: 2810443J12Rik, Wdr85
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67228
Homologene: 5432
Or5p6
Name: olfactory receptor family 5 subfamily P member 6
Synonyms: GA_x6K02T2PBJ9-10361879-10360935, MOR204-13, Olfr478
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258729
Homologene: 128076
Trim56
Name: tripartite motif-containing 56
Synonyms: LOC384309, RNF109, A130009K11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 384309
Homologene: 12812
Ssr1
Name: signal sequence receptor, alpha
Synonyms: SSR, TRAPalpha
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 107513
VEGA: 13
Homologene: 2368
Gm8444
Name: predicted gene 8444
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 667073
VEGA: 15
Fabp5
Name: fatty acid binding protein 5, epidermal
Synonyms: mal1, Fabpe E-FABP, Klbp, Unknown Klbp, keratinocyte lipid binding protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 16592
Homologene: 108238
Gm20636
Name: predicted gene 20636
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 105246968
Cmtm1
Name: CKLF-like MARVEL transmembrane domain containing 1
Synonyms: CHLFH1a, CKLFH1, Cklfsf1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100504164
Homologene: 134399
Vmn2r125
Name: vomeronasal 2, receptor 125
Synonyms: Gm20782
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 670059
VEGA: 4
Mir7039
Name: microRNA 7039
Synonyms: mmu-mir-7039
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 102465629
VEGA: 5
Mrgprx3-ps
Name: MAS-related GPR, member X3, pseudogene
Synonyms: LOC269919, Gm660, Gm19419
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 100502859
Or8a1b
Name: olfactory receptor family 8 subfamily A member 1B
Synonyms: M72, MOR171-3, MOR171-3, GA_x6K02T2PVTD-31389446-31388517, Olfr160
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 80706
HGNC: HGNC:8469
Homologene: 12726
Ighv1-20
Name: immunoglobulin heavy variable V1-20
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 668497
HGNC: HGNC:5553
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 73,928,098 bp
  • A to G, chromosome 1 at 153,468,926 bp
  • A to G, chromosome 2 at 24,963,500 bp
  • G to A, chromosome 2 at 53,146,172 bp
  • T to C, chromosome 2 at 76,775,974 bp
  • A to T, chromosome 2 at 111,328,815 bp
  • A to T, chromosome 2 at 119,186,385 bp
  • T to C, chromosome 2 at 131,085,814 bp
  • A to T, chromosome 2 at 156,020,544 bp
  • T to C, chromosome 3 at 10,012,648 bp
  • C to T, chromosome 3 at 88,909,276 bp
  • C to T, chromosome 4 at 44,931,335 bp
  • C to T, chromosome 4 at 137,518,940 bp
  • T to C, chromosome 4 at 156,350,087 bp
  • A to G, chromosome 5 at 64,953,638 bp
  • A to T, chromosome 5 at 87,327,689 bp
  • G to A, chromosome 5 at 112,375,030 bp
  • T to A, chromosome 5 at 137,113,687 bp
  • T to C, chromosome 5 at 144,896,775 bp
  • T to C, chromosome 7 at 12,906,324 bp
  • T to C, chromosome 7 at 19,287,324 bp
  • C to T, chromosome 7 at 30,056,367 bp
  • T to C, chromosome 7 at 47,309,826 bp
  • A to T, chromosome 7 at 89,806,726 bp
  • C to A, chromosome 7 at 108,031,544 bp
  • T to C, chromosome 7 at 130,979,474 bp
  • T to G, chromosome 7 at 141,110,695 bp
  • T to C, chromosome 7 at 143,184,442 bp
  • T to A, chromosome 8 at 18,934,167 bp
  • T to G, chromosome 8 at 69,805,292 bp
  • G to T, chromosome 8 at 71,478,741 bp
  • G to A, chromosome 8 at 71,713,547 bp
  • C to T, chromosome 8 at 77,720,302 bp
  • T to A, chromosome 8 at 91,275,699 bp
  • CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT to CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT, chromosome 8 at 104,309,470 bp
  • C to T, chromosome 8 at 109,624,119 bp
  • C to A, chromosome 8 at 121,117,700 bp
  • A to T, chromosome 9 at 37,712,068 bp
  • T to C, chromosome 10 at 42,698,234 bp
  • T to A, chromosome 10 at 80,783,988 bp
  • T to C, chromosome 11 at 61,701,728 bp
  • G to A, chromosome 11 at 105,348,431 bp
  • T to C, chromosome 11 at 110,090,104 bp
  • A to T, chromosome 12 at 114,724,199 bp
  • G to A, chromosome 13 at 37,985,290 bp
  • GCACCTCTGCTTCCTC to GCACCTCTGCTTCCTCACCTCTGCTTCCTC, chromosome 13 at 98,867,129 bp
  • T to A, chromosome 13 at 104,314,279 bp
  • T to C, chromosome 14 at 118,629,622 bp
  • G to A, chromosome 15 at 78,780,514 bp
  • A to G, chromosome 15 at 81,843,533 bp
  • G to A, chromosome 15 at 82,124,863 bp
  • T to C, chromosome 16 at 22,935,679 bp
  • A to T, chromosome 16 at 31,108,114 bp
  • G to A, chromosome 17 at 35,124,269 bp
  • A to T, chromosome 19 at 28,298,903 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4274 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041077-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.