Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4274Btlr/Mmmh
Stock Number:
041077-MU
Citation ID:
RRID:MMRRC_041077-MU
Other Names:
R4274 (G1), C57BL/6J-MtgxR4274Btlr
Major Collection:

Strain Information

Tnpo1
Name: transportin 1
Synonyms: D13Ertd688e, Kpnb2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238799
HGNC: HGNC:6401
Homologene: 5358
Tlr6
Name: toll-like receptor 6
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 21899
Homologene: 21223
Dnajc17
Name: DnaJ heat shock protein family (Hsp40) member C17
Synonyms: D9Bwg1371e, 1700025B16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69408
Homologene: 49527
Acap2
Name: ArfGAP with coiled-coil, ankyrin repeat and PH domains 2
Synonyms: 9530039J15Rik, Centb2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78618
VEGA: 16
Homologene: 8182
Dot1l
Name: DOT1 like histone lysine methyltransferase
Synonyms: mDot1, KMT4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 208266
Homologene: 32779
Dhx9
Name: DExH-box helicase 9
Synonyms: leukophysin, nuclear DNA helicase II, RNA helicase, Ddx9, NDH II, NDHII, RHA
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13211
HGNC: HGNC:2750
Homologene: 1039
Prpf40a
Name: pre-mRNA processing factor 40A
Synonyms: FBP11, 2810012K09Rik, Fnbp3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56194
Homologene: 6377
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 73,928,098 bp
  • A to G, chromosome 1 at 153,468,926 bp
  • A to G, chromosome 2 at 24,963,500 bp
  • G to A, chromosome 2 at 53,146,172 bp
  • T to C, chromosome 2 at 76,775,974 bp
  • A to T, chromosome 2 at 111,328,815 bp
  • A to T, chromosome 2 at 119,186,385 bp
  • T to C, chromosome 2 at 131,085,814 bp
  • A to T, chromosome 2 at 156,020,544 bp
  • T to C, chromosome 3 at 10,012,648 bp
  • C to T, chromosome 3 at 88,909,276 bp
  • C to T, chromosome 4 at 44,931,335 bp
  • C to T, chromosome 4 at 137,518,940 bp
  • T to C, chromosome 4 at 156,350,087 bp
  • A to G, chromosome 5 at 64,953,638 bp
  • A to T, chromosome 5 at 87,327,689 bp
  • G to A, chromosome 5 at 112,375,030 bp
  • T to A, chromosome 5 at 137,113,687 bp
  • T to C, chromosome 5 at 144,896,775 bp
  • T to C, chromosome 7 at 12,906,324 bp
  • T to C, chromosome 7 at 19,287,324 bp
  • C to T, chromosome 7 at 30,056,367 bp
  • T to C, chromosome 7 at 47,309,826 bp
  • A to T, chromosome 7 at 89,806,726 bp
  • C to A, chromosome 7 at 108,031,544 bp
  • T to C, chromosome 7 at 130,979,474 bp
  • T to G, chromosome 7 at 141,110,695 bp
  • T to C, chromosome 7 at 143,184,442 bp
  • T to A, chromosome 8 at 18,934,167 bp
  • T to G, chromosome 8 at 69,805,292 bp
  • G to T, chromosome 8 at 71,478,741 bp
  • G to A, chromosome 8 at 71,713,547 bp
  • C to T, chromosome 8 at 77,720,302 bp
  • T to A, chromosome 8 at 91,275,699 bp
  • CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT to CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT, chromosome 8 at 104,309,470 bp
  • C to T, chromosome 8 at 109,624,119 bp
  • C to A, chromosome 8 at 121,117,700 bp
  • A to T, chromosome 9 at 37,712,068 bp
  • T to C, chromosome 10 at 42,698,234 bp
  • T to A, chromosome 10 at 80,783,988 bp
  • T to C, chromosome 11 at 61,701,728 bp
  • G to A, chromosome 11 at 105,348,431 bp
  • T to C, chromosome 11 at 110,090,104 bp
  • A to T, chromosome 12 at 114,724,199 bp
  • G to A, chromosome 13 at 37,985,290 bp
  • GCACCTCTGCTTCCTC to GCACCTCTGCTTCCTCACCTCTGCTTCCTC, chromosome 13 at 98,867,129 bp
  • T to A, chromosome 13 at 104,314,279 bp
  • T to C, chromosome 14 at 118,629,622 bp
  • G to A, chromosome 15 at 78,780,514 bp
  • A to G, chromosome 15 at 81,843,533 bp
  • G to A, chromosome 15 at 82,124,863 bp
  • T to C, chromosome 16 at 22,935,679 bp
  • A to T, chromosome 16 at 31,108,114 bp
  • G to A, chromosome 17 at 35,124,269 bp
  • A to T, chromosome 19 at 28,298,903 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4274 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041077-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.