Strain Name:
C57BL/6J-MtgxR4559Btlr/Mmmh
Stock Number:
041785-MU
Citation ID:
RRID:MMRRC_041785-MU
Other Names:
R4559 (G1), C57BL/6J-MtgxR4559Btlr
Major Collection:

Gene Information

Sf1
Name: splicing factor 1
Synonyms: WBP4, Zfp162, MZFM, CW17R
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 22668
Homologene: 134065
Prkacb
Name: protein kinase, cAMP dependent, catalytic, beta
Synonyms: Pkacb, cAMP-dependent protein kinase C beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 18749
HGNC: HGNC:9381
Homologene: 121718
Slc6a12
Name: solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12
Synonyms: Gabt2, BGT1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 14411
Homologene: 128225
Frem2
Name: Fras1 related extracellular matrix protein 2
Synonyms: b2b1562Clo, my, 8430406N05Rik, 6030440P17Rik, ne
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 242022
Homologene: 18454
Grin3a
Name: glutamate receptor ionotropic, NMDA3A
Synonyms: NR3A, A830097C19Rik, NMDAR-L
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242443
Homologene: 128613
Denn2b
Name: DENN domain containing 2B
Synonyms: St5, 2010004M01Rik, 2610305K15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 76954
Homologene: 3951
Hdac5
Name: histone deacetylase 5
Synonyms: mHDA1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 15184
Homologene: 3995
Kif13b
Name: kinesin family member 13B
Synonyms: C130021D12Rik, 5330429L19Rik, N-3 kinesin, GAKIN
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 16554
VEGA: 14
Homologene: 9073
Sipa1l3
Name: signal-induced proliferation-associated 1 like 3
Synonyms: 2610511M17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 74206
Homologene: 77938
Atxn10
Name: ataxin 10
Synonyms: TEG-169, E46, Sca10, Tex169
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 54138
VEGA: 15
Homologene: 40858
Ing1
Name: inhibitor of growth family, member 1
Synonyms: p33Ing1, 2610028J21Rik, mING1h
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 26356
HGNC: HGNC:6062
Homologene: 40119
Fam122b
Name: family with sequence similarity 122, member B
Synonyms: 4632404H22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 78755
Homologene: 12700
Dsg4
Name: desmoglein 4
Synonyms: CDHF13, lah
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 16769
Homologene: 65341
Ptprm
Name: protein tyrosine phosphatase, receptor type, M
Synonyms: RPTPmu
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 19274
VEGA: 17
HGNC: HGNC:9675
Homologene: 37694
Oas1d
Name: 2'-5' oligoadenylate synthetase 1D
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100535
HGNC: HGNC:8086
Homologene: 110815
Rasa3
Name: RAS p21 protein activator 3
Synonyms: Ras GTPase-activating protein III, GAPIII activator 3, GAPIII, hlb381, scat, R-Ras gap
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 19414
Homologene: 7217
Il22ra2
Name: interleukin 22 receptor, alpha 2
Synonyms: Il-22bp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 237310
Homologene: 18657
Pfkl
Name: phosphofructokinase, liver, B-type
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 18641
HGNC: HGNC:8876
Homologene: 55668
Rab22a
Name: RAB22A, member RAS oncogene family
Synonyms: E130120E14Rik, Rab22, 3732413A17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 19334
HGNC: HGNC:9764
Homologene: 10782
Taf4b
Name: TATA-box binding protein associated factor 4b
Synonyms: 4932409F03Rik, TAFII105, Taf2c2, 2610524B04Rik, 105kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 72504
VEGA: 18
Homologene: 28266
Atad2b
Name: ATPase family, AAA domain containing 2B
Synonyms: D530031C13Rik, 1110014E10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 320817
VEGA: 12
Homologene: 86351
Cep192
Name: centrosomal protein 192
Synonyms: D430014P18Rik, 4631422C13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 70799
VEGA: 18
Homologene: 73526
Tnfrsf1a
Name: tumor necrosis factor receptor superfamily, member 1a
Synonyms: TNFAR, Tnfr1, CD120a, TNF receptor alpha chain, TNFRp55, TNFRI, TNF-R1, p55, TNFalpha-R1, TNF-R55, TNF-alpha-R1, TNF-R-I, TNFR60, p55-R, TNF-alphaR1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 21937
Homologene: 828
Med12l
Name: mediator complex subunit 12-like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 329650
Homologene: 43143
Fbn1
Name: fibrillin 1
Synonyms: Fib-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14118
HGNC: HGNC:3603
Homologene: 30958
Ttn
Name: titin
Synonyms: D830007G01Rik, L56, 1100001C23Rik, mdm, D330041I19Rik, 2310057K23Rik, 2310074I15Rik, 2310036G12Rik, shru, connectin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Il20ra
Name: interleukin 20 receptor, alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 237313
VEGA: 10
HGNC: HGNC:6003
Homologene: 8685
Plb1
Name: phospholipase B1
Synonyms: 4930433E17Rik, 4632413E21Rik, 4930539A06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 665270
Homologene: 82108
Cnga4
Name: cyclic nucleotide gated channel alpha 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233649
HGNC: HGNC:2152
Homologene: 13579
Fbn2
Name: fibrillin 2
Synonyms: sy, Fib-2, Sne
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 14119
VEGA: 18
HGNC: HGNC:3604
Homologene: 1515
Farp1
Name: FERM, RhoGEF (Arhgef) and pleckstrin domain protein 1 (chondrocyte-derived)
Synonyms: Cdep
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 223254
HGNC: HGNC:3591
Homologene: 38098
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: E130113P14Rik, bl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231470
Homologene: 23516
Psd3
Name: pleckstrin and Sec7 domain containing 3
Synonyms: EFA6D, 4931420C21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234353
Homologene: 87257
Acss1
Name: acyl-CoA synthetase short-chain family member 1
Synonyms: Acas2, Acas2l, 1110032O15Rik, AceCS2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 68738
Homologene: 56037
Ccdc150
Name: coiled-coil domain containing 150
Synonyms: 4930511H11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 78016
Homologene: 15814
Ift140
Name: intraflagellar transport 140
Synonyms: Tce5, Wdtc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 106633
Homologene: 40979
Adamts10
Name: a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 10
Synonyms: ZnMP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224697
Homologene: 81940
Olfr1247
Name: olfactory receptor 1247
Synonyms: GA_x6K02T2Q125-51051555-51050611, MOR231-6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258968
Homologene: 121536
Cyp2j12
Name: cytochrome P450, family 2, subfamily j, polypeptide 12
Synonyms: Cyp2j12-ps, OTTMUSG00000007939
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242546
Homologene: 133195
Olfr635
Name: olfactory receptor 635
Synonyms: GA_x6K02T2PBJ9-6713641-6714588, MOR5-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 259122
Homologene: 133592
Fam189a2
Name: family with sequence similarity 189, member A2
Synonyms: LOC381217
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 381217
VEGA: 19
Homologene: 3540
Slfn8
Name: schlafen 8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 276950
Homologene: 45432
P2ry2
Name: purinergic receptor P2Y, G-protein coupled 2
Synonyms: P2Y2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 18442
HGNC: HGNC:8541
Homologene: 1927
Jph1
Name: junctophilin 1
Synonyms: JP-1, mitsugumin72, ENSMUSG00000054314
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 57339
Homologene: 10761
Tgoln1
Name: trans-golgi network protein
Synonyms: TGN38, D6Ertd384e, Ttgn1, TGN38A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 22134
Homologene: 137224
Tlr12
Name: toll-like receptor 12
Synonyms: LOC384059, Tlr11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 384059
Homologene: 135964
Slc17a1
Name: solute carrier family 17 (sodium phosphate), member 1
Synonyms: Npt1, NAPI-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 20504
Homologene: 48324
Map10
Name: microtubule-associated protein 10
Synonyms: 4933403G14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 74393
Homologene: 10416
Nat8f1
Name: N-acetyltransferase 8 (GCN5-related) family member 1
Synonyms: 1110002I11Rik, Cml1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 66116
Homologene: 41446
Cidea
Name: cell death-inducing DNA fragmentation factor, alpha subunit-like effector A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 12683
VEGA: 18
HGNC: HGNC:1976
Homologene: 77852
Rab29
Name: RAB29, member RAS oncogene family
Synonyms: Rab7l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226422
HGNC: HGNC:9789
Homologene: 20842
1700066M21Rik
Name: RIKEN cDNA 1700066M21 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 73467
Homologene: 13624
2310001K24Rik
Name: RIKEN cDNA 2310001K24 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 69517
1700017G19Rik
Name: RIKEN cDNA 1700017G19 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 100040882
Gm10719
Name: predicted gene 10719
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
AC104930.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 17,004,511 bp
  • G to A, chromosome 1 at 54,353,013 bp
  • T to C, chromosome 1 at 57,382,924 bp
  • G to A, chromosome 1 at 131,872,567 bp
  • G to A, chromosome 2 at 76,919,546 bp
  • C to A, chromosome 2 at 89,609,699 bp
  • T to A, chromosome 2 at 125,351,714 bp
  • A to G, chromosome 2 at 150,638,485 bp
  • T to A, chromosome 2 at 163,472,673 bp
  • A to G, chromosome 2 at 173,661,433 bp
  • A to G, chromosome 3 at 40,513,091 bp
  • C to T, chromosome 3 at 53,654,321 bp
  • T to C, chromosome 3 at 59,007,102 bp
  • A to G, chromosome 3 at 146,745,392 bp
  • T to C, chromosome 4 at 49,844,555 bp
  • G to T, chromosome 4 at 96,112,957 bp
  • C to A, chromosome 4 at 128,615,770 bp
  • T to A, chromosome 5 at 32,332,831 bp
  • A to G, chromosome 5 at 96,781,289 bp
  • C to A, chromosome 5 at 120,916,895 bp
  • T to C, chromosome 6 at 72,615,681 bp
  • A to G, chromosome 6 at 85,910,585 bp
  • G to A, chromosome 6 at 121,363,861 bp
  • A to G, chromosome 6 at 125,360,766 bp
  • A to T, chromosome 7 at 29,332,253 bp
  • A to G, chromosome 7 at 100,998,156 bp
  • G to A, chromosome 7 at 103,979,560 bp
  • A to G, chromosome 7 at 105,405,685 bp
  • A to G, chromosome 7 at 109,525,578 bp
  • A to G, chromosome 7 at 112,955,131 bp
  • A to G, chromosome 8 at 11,562,090 bp
  • T to C, chromosome 8 at 13,598,259 bp
  • T to A, chromosome 8 at 67,960,647 bp
  • A to G, chromosome 8 at 125,671,814 bp
  • A to T, chromosome 9 at 3,018,945 bp
  • A to G, chromosome 10 at 19,626,712 bp
  • A to G, chromosome 10 at 19,749,284 bp
  • G to T, chromosome 10 at 77,988,883 bp
  • A to G, chromosome 11 at 83,004,744 bp
  • T to C, chromosome 11 at 102,199,102 bp
  • A to G, chromosome 12 at 4,943,223 bp
  • A to T, chromosome 13 at 23,878,712 bp
  • G to T, chromosome 14 at 64,806,132 bp
  • T to C, chromosome 14 at 121,272,801 bp
  • A to G, chromosome 15 at 85,438,120 bp
  • C to A, chromosome 17 at 25,090,767 bp
  • A to T, chromosome 17 at 33,538,375 bp
  • A to T, chromosome 17 at 66,683,408 bp
  • T to C, chromosome 18 at 14,813,526 bp
  • T to A, chromosome 18 at 20,470,921 bp
  • C to T, chromosome 18 at 58,076,074 bp
  • C to T, chromosome 18 at 67,360,228 bp
  • T to A, chromosome 18 at 67,871,513 bp
  • GGCAGCAGCAGCAGCAGCAGC to GGCAGCAGCAGCAGCAGC, chromosome 19 at 6,374,815 bp
  • G to A, chromosome 19 at 24,030,549 bp
  • G to A, chromosome X at 53,260,677 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4559 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
041785-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.