Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4744Btlr/Mmmh
Stock Number:
042027-MU
Citation ID:
RRID:MMRRC_042027-MU
Other Names:
R4744 (G1), C57BL/6J-MtgxR4744Btlr
Major Collection:

Strain Information

Sufu
Name: SUFU negative regulator of hedgehog signaling
Synonyms: Su(Fu), 2810026F04Rik, b2b273Clo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 24069
Homologene: 9262
Slc1a2
Name: solute carrier family 1 (glial high affinity glutamate transporter), member 2
Synonyms: GLT1, MGLT1, Eaat2, 1700091C19Rik, GLT-1, 2900019G14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20511
Homologene: 3075
Gcg
Name: glucagon
Synonyms: GLP-1, glucagon-like peptide I, Glu, PPG
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14526
HGNC: HGNC:4191
Homologene: 1553
Septin3
Name: septin 3
Synonyms: Sep3, B530002E20Rik, 3110018K01Rik, Gm46500, Sept3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 24050
VEGA: 15
Homologene: 99740
Rbm47
Name: RNA binding motif protein 47
Synonyms: 9530077J19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 245945
Homologene: 36932
Jak2
Name: Janus kinase 2
Synonyms: C81284
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16452
VEGA: 19
HGNC: HGNC:6192
Homologene: 21033
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 59,484,436 bp
  • A to T, chromosome 1 at 135,982,458 bp
  • T to G, chromosome 1 at 150,577,612 bp
  • T to A, chromosome 1 at 171,460,598 bp
  • T to C, chromosome 2 at 3,224,909 bp
  • A to G, chromosome 2 at 32,618,543 bp
  • A to T, chromosome 2 at 36,640,979 bp
  • T to C, chromosome 2 at 52,150,577 bp
  • T to A, chromosome 2 at 62,478,631 bp
  • A to G, chromosome 2 at 102,737,869 bp
  • A to T, chromosome 2 at 103,042,296 bp
  • A to G, chromosome 2 at 120,696,123 bp
  • A to T, chromosome 2 at 121,211,313 bp
  • A to T, chromosome 2 at 122,522,805 bp
  • A to T, chromosome 2 at 130,100,629 bp
  • G to T, chromosome 3 at 136,247,689 bp
  • T to C, chromosome 4 at 48,397,609 bp
  • A to G, chromosome 4 at 48,469,990 bp
  • G to T, chromosome 4 at 55,011,598 bp
  • A to T, chromosome 4 at 117,867,895 bp
  • T to C, chromosome 5 at 8,078,699 bp
  • T to C, chromosome 5 at 63,806,967 bp
  • T to C, chromosome 5 at 66,026,693 bp
  • T to A, chromosome 5 at 108,808,581 bp
  • T to C, chromosome 5 at 114,879,556 bp
  • T to C, chromosome 5 at 115,251,414 bp
  • T to A, chromosome 5 at 121,662,130 bp
  • T to C, chromosome 5 at 137,835,507 bp
  • A to G, chromosome 6 at 86,110,888 bp
  • G to A, chromosome 6 at 125,228,285 bp
  • G to A, chromosome 6 at 135,778,699 bp
  • A to C, chromosome 6 at 143,186,593 bp
  • T to C, chromosome 7 at 28,777,013 bp
  • T to A, chromosome 7 at 28,787,780 bp
  • A to T, chromosome 7 at 30,954,772 bp
  • T to C, chromosome 7 at 75,206,518 bp
  • G to T, chromosome 7 at 107,750,277 bp
  • A to G, chromosome 8 at 71,372,753 bp
  • A to G, chromosome 8 at 105,965,989 bp
  • G to A, chromosome 9 at 3,344,604 bp
  • A to G, chromosome 9 at 15,010,298 bp
  • T to C, chromosome 9 at 59,905,996 bp
  • T to C, chromosome 9 at 73,931,844 bp
  • T to A, chromosome 9 at 74,850,871 bp
  • T to C, chromosome 9 at 100,506,744 bp
  • T to C, chromosome 9 at 119,431,262 bp
  • A to G, chromosome 10 at 75,585,899 bp
  • T to C, chromosome 10 at 127,090,203 bp
  • A to G, chromosome 11 at 11,801,585 bp
  • A to G, chromosome 11 at 43,036,690 bp
  • A to G, chromosome 11 at 56,040,835 bp
  • T to C, chromosome 11 at 72,175,539 bp
  • G to A, chromosome 11 at 84,994,393 bp
  • T to A, chromosome 11 at 87,622,791 bp
  • A to G, chromosome 11 at 120,016,122 bp
  • T to A, chromosome 12 at 66,797,727 bp
  • T to A, chromosome 12 at 72,652,251 bp
  • A to T, chromosome 12 at 108,319,979 bp
  • T to A, chromosome 13 at 19,751,714 bp
  • A to G, chromosome 14 at 61,360,233 bp
  • A to G, chromosome 14 at 69,794,002 bp
  • T to A, chromosome 15 at 9,310,553 bp
  • T to C, chromosome 15 at 82,290,457 bp
  • T to A, chromosome 15 at 91,797,474 bp
  • A to G, chromosome 15 at 98,894,258 bp
  • C to T, chromosome 16 at 11,349,909 bp
  • G to A, chromosome 16 at 17,803,516 bp
  • A to T, chromosome 16 at 31,945,333 bp
  • T to A, chromosome 16 at 77,114,989 bp
  • A to T, chromosome 17 at 20,114,003 bp
  • G to T, chromosome 17 at 73,507,833 bp
  • A to G, chromosome 18 at 39,774,828 bp
  • TGCCGCCGCCGCCGCCGCCGCCGCCGCC to TGCCGCCGCCGCCGCCGCCGCCGCC, chromosome 18 at 43,477,717 bp
  • A to T, chromosome 19 at 28,894,525 bp
  • T to A, chromosome 19 at 29,262,256 bp
  • A to G, chromosome 19 at 46,483,630 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4744 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042027-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.