Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4856Btlr/Mmmh
Stock Number:
042467-MU
Citation ID:
RRID:MMRRC_042467-MU
Other Names:
R4856 (G1), C57BL/6J-MtgxR4856Btlr
Major Collection:

Strain Information

Vps41
Name: VPS41 HOPS complex subunit
Synonyms: Vam2, mVam2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218035
VEGA: 13
Homologene: 69165
Notch2
Name: notch 2
Synonyms: Motch B, N2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18129
HGNC: HGNC:7882
Homologene: 7865
Elavl3
Name: ELAV like RNA binding protein 3
Synonyms: mHuC, Huc, 2600009P04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 15571
VEGA: 9
HGNC: HGNC:3314
Homologene: 31035
Olr1
Name: oxidized low density lipoprotein (lectin-like) receptor 1
Synonyms: LOX-1, Scare1, SR-EI
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108078
HGNC: HGNC:8133
Homologene: 1910
Scn3a
Name: sodium channel, voltage-gated, type III, alpha
Synonyms: LOC381367, Nav1.3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20269
Homologene: 56005
Jam2
Name: junction adhesion molecule 2
Synonyms: 2410030G21Rik, JAM-2, VE-JAM, 2410167M24Rik, Jcam2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67374
Homologene: 10929
Zbtb43
Name: zinc finger and BTB domain containing 43
Synonyms: 1700010E06Rik, Zfp297b
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71834
Homologene: 8514
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 119,934,204 bp
  • T to A, chromosome 1 at 119,984,758 bp
  • T to A, chromosome 1 at 133,706,780 bp
  • T to C, chromosome 1 at 171,384,815 bp
  • T to C, chromosome 2 at 22,410,700 bp
  • C to T, chromosome 2 at 27,244,477 bp
  • T to C, chromosome 2 at 33,453,932 bp
  • T to A, chromosome 2 at 35,402,791 bp
  • T to C, chromosome 2 at 65,461,032 bp
  • T to C, chromosome 2 at 76,731,300 bp
  • T to C, chromosome 2 at 152,369,611 bp
  • T to C, chromosome 2 at 157,318,044 bp
  • A to G, chromosome 3 at 32,437,163 bp
  • G to T, chromosome 3 at 57,847,453 bp
  • A to T, chromosome 3 at 98,102,419 bp
  • A to G, chromosome 3 at 108,676,838 bp
  • A to T, chromosome 3 at 129,983,970 bp
  • A to T, chromosome 3 at 138,148,385 bp
  • C to G, chromosome 3 at 146,469,774 bp
  • G to A, chromosome 4 at 12,089,416 bp
  • A to C, chromosome 4 at 84,971,229 bp
  • T to C, chromosome 4 at 109,068,367 bp
  • T to C, chromosome 4 at 115,252,881 bp
  • T to C, chromosome 4 at 126,262,488 bp
  • G to T, chromosome 4 at 143,853,303 bp
  • C to T, chromosome 4 at 149,982,778 bp
  • A to G, chromosome 5 at 73,608,567 bp
  • A to T, chromosome 5 at 88,488,734 bp
  • G to T, chromosome 5 at 92,943,086 bp
  • A to G, chromosome 5 at 93,392,749 bp
  • G to A, chromosome 5 at 136,743,058 bp
  • T to C, chromosome 6 at 29,447,890 bp
  • T to C, chromosome 6 at 83,028,353 bp
  • G to A, chromosome 6 at 119,278,256 bp
  • A to T, chromosome 6 at 128,384,988 bp
  • T to A, chromosome 6 at 129,493,596 bp
  • G to A, chromosome 6 at 140,644,073 bp
  • A to C, chromosome 6 at 148,873,011 bp
  • T to A, chromosome 7 at 3,240,442 bp
  • T to C, chromosome 7 at 5,454,533 bp
  • A to G, chromosome 7 at 16,215,442 bp
  • A to G, chromosome 7 at 25,246,211 bp
  • T to A, chromosome 7 at 106,873,970 bp
  • A to T, chromosome 7 at 131,561,568 bp
  • T to A, chromosome 8 at 3,716,419 bp
  • A to C, chromosome 8 at 66,481,477 bp
  • A to T, chromosome 8 at 75,888,600 bp
  • G to A, chromosome 8 at 94,351,810 bp
  • T to A, chromosome 8 at 94,563,964 bp
  • T to A, chromosome 8 at 125,670,692 bp
  • T to A, chromosome 9 at 16,021,330 bp
  • T to C, chromosome 9 at 22,026,318 bp
  • A to T, chromosome 9 at 38,403,468 bp
  • T to A, chromosome 9 at 51,280,325 bp
  • T to C, chromosome 9 at 57,545,307 bp
  • T to C, chromosome 9 at 58,157,606 bp
  • T to C, chromosome 9 at 108,672,502 bp
  • C to T, chromosome 9 at 111,390,085 bp
  • C to A, chromosome 9 at 119,694,309 bp
  • C to T, chromosome 9 at 119,694,310 bp
  • T to A, chromosome 10 at 18,123,625 bp
  • TTTGCGCATT to TTT, chromosome 10 at 27,043,643 bp
  • G to T, chromosome 10 at 85,148,770 bp
  • A to G, chromosome 11 at 32,277,008 bp
  • A to G, chromosome 11 at 102,025,136 bp
  • T to C, chromosome 11 at 115,260,790 bp
  • G to A, chromosome 11 at 116,069,976 bp
  • C to T, chromosome 12 at 65,143,311 bp
  • C to A, chromosome 12 at 115,193,803 bp
  • C to A, chromosome 12 at 115,567,154 bp
  • A to G, chromosome 13 at 17,719,734 bp
  • G to A, chromosome 13 at 18,829,255 bp
  • T to C, chromosome 13 at 19,185,066 bp
  • A to T, chromosome 13 at 27,319,000 bp
  • G to A, chromosome 13 at 37,931,058 bp
  • A to T, chromosome 13 at 49,522,787 bp
  • A to G, chromosome 13 at 55,638,199 bp
  • A to G, chromosome 14 at 30,936,701 bp
  • T to A, chromosome 14 at 65,815,201 bp
  • T to C, chromosome 14 at 110,751,883 bp
  • A to G, chromosome 14 at 119,035,964 bp
  • T to C, chromosome 15 at 5,105,141 bp
  • G to T, chromosome 15 at 51,968,500 bp
  • T to A, chromosome 15 at 75,326,652 bp
  • A to G, chromosome 15 at 79,728,403 bp
  • G to A, chromosome 16 at 84,801,602 bp
  • T to C, chromosome 16 at 94,390,283 bp
  • G to T, chromosome 17 at 23,308,034 bp
  • T to A, chromosome 17 at 35,015,726 bp
  • A to G, chromosome 17 at 35,672,723 bp
  • A to T, chromosome 17 at 37,952,071 bp
  • A to T, chromosome 18 at 21,557,972 bp
  • C to T, chromosome 18 at 43,766,754 bp
  • G to A, chromosome 18 at 60,916,651 bp
  • C to T, chromosome 19 at 8,829,827 bp
  • T to C, chromosome 19 at 13,454,521 bp
  • T to A, chromosome 19 at 13,838,279 bp
  • C to T, chromosome 19 at 42,788,957 bp
  • GAGCAGCAGCAGCAGCAGCAGCAGCAGC to GAGCAGCAGCAGCAGCAGCAGCAGC, chromosome 19 at 46,083,155 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4856 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042467-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.