Strain Name:
C57BL/6J-MtgxR4856Btlr/Mmmh
Stock Number:
042467-MU
Citation ID:
RRID:MMRRC_042467-MU
Other Names:
R4856 (G1), C57BL/6J-MtgxR4856Btlr
Major Collection:

Gene Information

Vps41
Name: VPS41 HOPS complex subunit
Synonyms: Vam2, mVam2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218035
VEGA: 13
Homologene: 69165
Notch2
Name: notch 2
Synonyms: Motch B, N2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 18129
HGNC: HGNC:7882
Homologene: 7865
Elavl3
Name: ELAV like RNA binding protein 3
Synonyms: 2600009P04Rik, mHuC, Huc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 15571
VEGA: 9
HGNC: HGNC:3314
Homologene: 31035
Olr1
Name: oxidized low density lipoprotein (lectin-like) receptor 1
Synonyms: LOX-1, SR-EI, Scare1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 108078
HGNC: HGNC:8133
Homologene: 1910
Scn3a
Name: sodium channel, voltage-gated, type III, alpha
Synonyms: Nav1.3, LOC381367
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20269
Homologene: 56005
Jam2
Name: junction adhesion molecule 2
Synonyms: Jcam2, 2410030G21Rik, JAM-2, VE-JAM, 2410167M24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 67374
Homologene: 10929
Zbtb43
Name: zinc finger and BTB domain containing 43
Synonyms: 1700010E06Rik, Zfp297b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 71834
Homologene: 8514
Ggta1
Name: glycoprotein galactosyltransferase alpha 1, 3
Synonyms: alpha3GalT, glycoprotein alpha galactosyl transferase 1, GALT, alpha Gal, Ggta, Gal, Ggta-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 14594
HGNC: HGNC:4253
Homologene: 7730
Cdk13
Name: cyclin-dependent kinase 13
Synonyms: Cdc2l5, 2310015O17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 69562
VEGA: 13
HGNC: HGNC:1733
Homologene: 135707
Shroom3
Name: shroom family member 3
Synonyms: Shrm, Shrm3, D5Ertd287e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 27428
Homologene: 9263
Ttc3
Name: tetratricopeptide repeat domain 3
Synonyms: 2610202A04Rik, D16Ium21, D16Ium21e, TPRD
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 22129
Homologene: 2487
Reps1
Name: RalBP1 associated Eps domain containing protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 19707
Homologene: 7515
Aebp2
Name: AE binding protein 2
Synonyms: B230313N05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 11569
Homologene: 40690
Bub3
Name: BUB3 mitotic checkpoint protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 12237
HGNC: HGNC:1151
Homologene: 3470
Cry1
Name: cryptochrome 1 (photolyase-like)
Synonyms: Phll1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 12952
VEGA: 10
HGNC: HGNC:2384
Homologene: 7042
Ddx46
Name: DEAD (Asp-Glu-Ala-Asp) box polypeptide 46
Synonyms: 2200005K02Rik, 8430438J23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 212880
VEGA: 13
Homologene: 5430
Unc13d
Name: unc-13 homolog D
Synonyms: Munc13-4, Jinx, 2610108D09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 70450
Homologene: 26714
Slc12a3
Name: solute carrier family 12, member 3
Synonyms: TSC, NCC
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 20497
Homologene: 287
Slitrk6
Name: SLIT and NTRK-like family, member 6
Synonyms: 4832410J21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 239250
VEGA: 14
Homologene: 12986
Clcc1
Name: chloride channel CLIC-like 1
Synonyms: Mclc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229725
Homologene: 9032
Vars
Name: valyl-tRNA synthetase
Synonyms: Vars2, Bat-6, D17H6S56E, Bat6, G7a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 22321
Homologene: 4587
Card6
Name: caspase recruitment domain family, member 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 239319
Homologene: 13067
Scn10a
Name: sodium channel, voltage-gated, type X, alpha
Synonyms: Nav1.8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 20264
VEGA: 9
Homologene: 21300
Grin2c
Name: glutamate receptor, ionotropic, NMDA2C (epsilon 3)
Synonyms: NR2C, GluRepsilon3, NMDAR2C
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 14813
HGNC: HGNC:4587
Homologene: 647
Sun2
Name: Sad1 and UNC84 domain containing 2
Synonyms: B230369L08Rik, Unc84b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223697
Homologene: 9113
Trappc3
Name: trafficking protein particle complex 3
Synonyms: 1110058K12Rik, Bet3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 27096
Homologene: 6399
Erf
Name: Ets2 repressor factor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 13875
HGNC: HGNC:3444
Homologene: 68516
Osbpl9
Name: oxysterol binding protein-like 9
Synonyms: 2600011I06Rik, ORP-9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 100273
Homologene: 69380
Rreb1
Name: ras responsive element binding protein 1
Synonyms: 1110037N09Rik, B930013M22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 68750
Homologene: 2218
Clec4g
Name: C-type lectin domain family 4, member g
Synonyms: 4930572L20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 75863
Homologene: 18879
Mpp3
Name: membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)
Synonyms: Dlgh3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 13384
HGNC: HGNC:7221
Homologene: 31065
Rpn2
Name: ribophorin II
Synonyms: Rpn-2, 1300012C06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20014
Homologene: 2214
M1ap
Name: meiosis 1 associated protein
Synonyms: D6Mm5e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 110958
Homologene: 13210
Hnrnpul2
Name: heterogeneous nuclear ribonucleoprotein U-like 2
Synonyms: 1110031M08Rik, Hnrpul2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 68693
VEGA: 19
Homologene: 28583
Nolc1
Name: nucleolar and coiled-body phosphoprotein 1
Synonyms: 3230402K17Rik, NOPP140, P130
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 70769
VEGA: 19
Slc25a20
Name: solute carrier family 25 (mitochondrial carnitine/acylcarnitine translocase), member 20
Synonyms: Cact, mCAC, 1110007P09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 57279
HGNC: HGNC:1421
Homologene: 331
Sec24b
Name: Sec24 related gene family, member B (S. cerevisiae)
Synonyms: SEC24
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 99683
Homologene: 55968
Mis18bp1
Name: MIS18 binding protein 1
Synonyms: C79407
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217653
Homologene: 10147
Caprin2
Name: caprin family member 2
Synonyms: Eeg1, C1qdc1, RNG140
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 232560
Homologene: 11393
Enam
Name: enamelin
Synonyms: abte
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 13801
HGNC: HGNC:3344
Homologene: 9698
Atp2b4
Name: ATPase, Ca++ transporting, plasma membrane 4
Synonyms: PMCA4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 381290
HGNC: HGNC:817
Homologene: 48034
Lama2
Name: laminin, alpha 2
Synonyms: merosin, mer
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 16773
HGNC: HGNC:6482
Homologene: 37306
Ttn
Name: titin
Synonyms: D330041I19Rik, mdm, L56, connectin, 2310074I15Rik, 2310057K23Rik, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, shru
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Uggt2
Name: UDP-glucose glycoprotein glucosyltransferase 2
Synonyms: 1810064L21Rik, 3110001A05Rik, A230065J02Rik, 3110027P15Rik, Ugcgl2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 66435
Homologene: 56875
Klhl14
Name: kelch-like 14
Synonyms: 6330403N15Rik, printor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 225266
Homologene: 28121
Fat3
Name: FAT atypical cadherin 3
Synonyms: LOC382129, 9430076A06Rik, D430038H04Rik, LOC234973
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 270120
VEGA: 9
Homologene: 82252
Arsi
Name: arylsulfatase i
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 545260
Homologene: 44428
Cpne2
Name: copine II
Synonyms: 3322401K10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234577
HGNC: HGNC:2315
Homologene: 27392
Prl6a1
Name: prolactin family 6, subfamily a, member 1
Synonyms: PLP-B, Prlpb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 19111
Homologene: 49261
Nlrp12
Name: NLR family, pyrin domain containing 12
Synonyms: Nalp12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 378425
Homologene: 16972
Vmn1r59
Name: vomeronasal 1 receptor 59
Synonyms: V1rd10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 404284
Homologene: 41799
Trank1
Name: tetratricopeptide repeat and ankyrin repeat containing 1
Synonyms: Lba1, LOC235639, A230061D21Rik, C030048J01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 320429
Homologene: 45845
Ecm2
Name: extracellular matrix protein 2, female organ and adipocyte specific
Synonyms: 9030618O22Rik, tenonectin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 407800
VEGA: 13
HGNC: HGNC:3154
Homologene: 1064
Iqcm
Name: IQ motif containing M
Synonyms: 1700007B14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 71831
Homologene: 53050
Tma16
Name: translation machinery associated 16
Synonyms: 1810029B16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 66282
Homologene: 10146
Pbk
Name: PDZ binding kinase
Synonyms: D14Ertd732e, TOPK, 2810434B10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 52033
Homologene: 32415
Pik3ca
Name: phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha
Synonyms: p110alpha, caPI3K, 6330412C24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 18706
HGNC: HGNC:8975
Homologene: 21249
Itih1
Name: inter-alpha trypsin inhibitor, heavy chain 1
Synonyms: Intin1, inter-alpha (globulin) inhibitor, H1 polypeptide, Itih-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 16424
HGNC: HGNC:6166
Homologene: 1667
Trgv4
Name: T cell receptor gamma, variable 4
Synonyms: Tcrg-V4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 21638
Vmn2r114
Name: vomeronasal 2, receptor 114
Synonyms: EG666002
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 666002
Homologene: 86604
Cntln
Name: centlein, centrosomal protein
Synonyms: B430108F07Rik, D530005L17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 338349
Homologene: 9805
Flnc
Name: filamin C, gamma
Synonyms: 1110055E19Rik, Fln2, actin binding protein 280
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 68794
HGNC: HGNC:3756
Homologene: 37481
Gtf2h4
Name: general transcription factor II H, polypeptide 4
Synonyms: p52
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 14885
HGNC: HGNC:4658
Homologene: 7090
Rad21
Name: RAD21 cohesin complex component
Synonyms: SCC1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 19357
VEGA: 15
HGNC: HGNC:9811
Homologene: 38161
Lrrc66
Name: leucine rich repeat containing 66
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231296
Homologene: 51944
Cacna2d4
Name: calcium channel, voltage-dependent, alpha 2/delta subunit 4
Synonyms: 5730412N02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 319734
Homologene: 26544
Hpse2
Name: heparanase 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 545291
VEGA: 19
Homologene: 19680
Gm13103
Name: predicted gene 13103
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 194225
Homologene: 129883
Olfr1501
Name: olfactory receptor 1501
Synonyms: MOR212-3, GA_x6K02T2RE5P-4171358-4170411
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 258626
Homologene: 64899
Dhx34
Name: DEAH (Asp-Glu-Ala-His) box polypeptide 34
Synonyms: Ddx34, 1200013B07Rik, 1810012L18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 71723
Homologene: 69171
Sardh
Name: sarcosine dehydrogenase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 192166
Homologene: 5149
Tmem67
Name: transmembrane protein 67
Synonyms: 5330408M12Rik, b2b1163.1Clo, b2b1291.1Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 329795
Homologene: 71886
Cyp4a29
Name: cytochrome P450, family 4, subfamily a, polypeptide 29
Synonyms: Cyp4a29-ps
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230639
Cfap221
Name: cilia and flagella associated protein 221
Synonyms: Gm101, Pcdp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226356
Homologene: 88578
Tex52
Name: testis expressed 52
Synonyms: 4933413G19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 71149
Homologene: 130761
2010007H06Rik
Name: RIKEN cDNA 2010007H06 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 102635638
H6pd
Name: hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)
Synonyms: G6pd1, Gpd1, Gpd-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 100198
HGNC: HGNC:4795
Homologene: 48275
Nrsn2
Name: neurensin 2
Synonyms: Neurensin-2, LOC228777
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228777
Homologene: 11802
Spata1
Name: spermatogenesis associated 1
Synonyms: SP-2, 4921536I21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 70951
Homologene: 23356
Col26a1
Name: collagen, type XXVI, alpha 1
Synonyms: Emid2, Emu2, 9430032K24Rik, Collagen XXVI
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 140709
Homologene: 136636
Olfr705
Name: olfactory receptor 705
Synonyms: GA_x6K02T2PBJ9-9256348-9255398, MOR283-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 259034
Homologene: 128075
Olfr1472
Name: olfactory receptor 1472
Synonyms: GA_x6K02T2RE5P-3787124-3786180, MOR202-16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 258685
Homologene: 77370
Mpi
Name: mannose phosphate isomerase
Synonyms: Mpi1, Mpi-1, 1110002E17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 110119
HGNC: HGNC:7216
Homologene: 1825
Scgb3a2
Name: secretoglobin, family 3A, member 2
Synonyms: LuLeu1, UGRP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 117158
Homologene: 14274
Trmt10a
Name: tRNA methyltransferase 10A
Synonyms: Rg9mtd2, 3110023L08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 108943
Homologene: 6886
Olfr761
Name: olfactory receptor 761
Synonyms: Olfr1552-ps1, GA_x6K02T2PSCP-2403971-2403000, MOR218-6P, MOR218-6P, MOR218-5P, MOR218-12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 258094
Homologene: 134080
Map10
Name: microtubule-associated protein 10
Synonyms: 4933403G14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 74393
Homologene: 10416
Islr
Name: immunoglobulin superfamily containing leucine-rich repeat
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 26968
VEGA: 9
HGNC: HGNC:6133
Homologene: 4050
Olfr147
Name: olfactory receptor 147
Synonyms: MOR164-1, M3, GA_x6K02T2PVTD-32098059-32099003
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258869
VEGA: 9
Homologene: 128279
Pfn2
Name: profilin 2
Synonyms: Pfn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 18645
HGNC: HGNC:8882
Homologene: 1974
Nectin4
Name: nectin cell adhesion molecule 4
Synonyms: Prr4, Pvrl4, 1200017F15Rik, nectin 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 71740
Homologene: 32744
Hba-x
Name: hemoglobin X, alpha-like embryonic chain in Hba complex
Synonyms: zeta globin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 15126
HGNC: HGNC:4835
Homologene: 110705
Kat2b-ps
Name: K(lysine) acetyltransferase 2B, pseudogene
Synonyms: P/CAF pseudogene, Pcaf-ps
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100504388
Gm28113
Name: predicted gene 28113
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Gm13342
Name: predicted gene 13342
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 102637566
Homologene: 138769
Ighv1-54
Name: immunoglobulin heavy variable V1-54
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 211331
Ighv8-11
Name: immunoglobulin heavy variable V8-11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 636462
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 119,934,204 bp
  • T to A, chromosome 1 at 119,984,758 bp
  • T to A, chromosome 1 at 133,706,780 bp
  • T to C, chromosome 1 at 171,384,815 bp
  • T to C, chromosome 2 at 22,410,700 bp
  • C to T, chromosome 2 at 27,244,477 bp
  • T to C, chromosome 2 at 33,453,932 bp
  • T to A, chromosome 2 at 35,402,791 bp
  • T to C, chromosome 2 at 65,461,032 bp
  • T to C, chromosome 2 at 76,731,300 bp
  • T to C, chromosome 2 at 152,369,611 bp
  • T to C, chromosome 2 at 157,318,044 bp
  • A to G, chromosome 3 at 32,437,163 bp
  • G to T, chromosome 3 at 57,847,453 bp
  • A to T, chromosome 3 at 98,102,419 bp
  • A to G, chromosome 3 at 108,676,838 bp
  • A to T, chromosome 3 at 129,983,970 bp
  • A to T, chromosome 3 at 138,148,385 bp
  • C to G, chromosome 3 at 146,469,774 bp
  • G to A, chromosome 4 at 12,089,416 bp
  • A to C, chromosome 4 at 84,971,229 bp
  • T to C, chromosome 4 at 109,068,367 bp
  • T to C, chromosome 4 at 115,252,881 bp
  • T to C, chromosome 4 at 126,262,488 bp
  • G to T, chromosome 4 at 143,853,303 bp
  • C to T, chromosome 4 at 149,982,778 bp
  • A to G, chromosome 5 at 73,608,567 bp
  • A to T, chromosome 5 at 88,488,734 bp
  • G to T, chromosome 5 at 92,943,086 bp
  • A to G, chromosome 5 at 93,392,749 bp
  • G to A, chromosome 5 at 136,743,058 bp
  • T to C, chromosome 6 at 29,447,890 bp
  • T to C, chromosome 6 at 83,028,353 bp
  • G to A, chromosome 6 at 119,278,256 bp
  • A to T, chromosome 6 at 128,384,988 bp
  • T to A, chromosome 6 at 129,493,596 bp
  • G to A, chromosome 6 at 140,644,073 bp
  • A to C, chromosome 6 at 148,873,011 bp
  • T to A, chromosome 7 at 3,240,442 bp
  • T to C, chromosome 7 at 5,454,533 bp
  • A to G, chromosome 7 at 16,215,442 bp
  • A to G, chromosome 7 at 25,246,211 bp
  • T to A, chromosome 7 at 106,873,970 bp
  • A to T, chromosome 7 at 131,561,568 bp
  • T to A, chromosome 8 at 3,716,419 bp
  • A to C, chromosome 8 at 66,481,477 bp
  • A to T, chromosome 8 at 75,888,600 bp
  • G to A, chromosome 8 at 94,351,810 bp
  • T to A, chromosome 8 at 94,563,964 bp
  • T to A, chromosome 8 at 125,670,692 bp
  • T to A, chromosome 9 at 16,021,330 bp
  • T to C, chromosome 9 at 22,026,318 bp
  • A to T, chromosome 9 at 38,403,468 bp
  • T to A, chromosome 9 at 51,280,325 bp
  • T to C, chromosome 9 at 57,545,307 bp
  • T to C, chromosome 9 at 58,157,606 bp
  • T to C, chromosome 9 at 108,672,502 bp
  • C to T, chromosome 9 at 111,390,085 bp
  • C to A, chromosome 9 at 119,694,309 bp
  • C to T, chromosome 9 at 119,694,310 bp
  • T to A, chromosome 10 at 18,123,625 bp
  • TTTGCGCATT to TTT, chromosome 10 at 27,043,643 bp
  • G to T, chromosome 10 at 85,148,770 bp
  • A to G, chromosome 11 at 32,277,008 bp
  • A to G, chromosome 11 at 102,025,136 bp
  • T to C, chromosome 11 at 115,260,790 bp
  • G to A, chromosome 11 at 116,069,976 bp
  • C to T, chromosome 12 at 65,143,311 bp
  • C to A, chromosome 12 at 115,193,803 bp
  • C to A, chromosome 12 at 115,567,154 bp
  • A to G, chromosome 13 at 17,719,734 bp
  • G to A, chromosome 13 at 18,829,255 bp
  • T to C, chromosome 13 at 19,185,066 bp
  • A to T, chromosome 13 at 27,319,000 bp
  • G to A, chromosome 13 at 37,931,058 bp
  • A to T, chromosome 13 at 49,522,787 bp
  • A to G, chromosome 13 at 55,638,199 bp
  • A to G, chromosome 14 at 30,936,701 bp
  • T to A, chromosome 14 at 65,815,201 bp
  • T to C, chromosome 14 at 110,751,883 bp
  • A to G, chromosome 14 at 119,035,964 bp
  • T to C, chromosome 15 at 5,105,141 bp
  • G to T, chromosome 15 at 51,968,500 bp
  • T to A, chromosome 15 at 75,326,652 bp
  • A to G, chromosome 15 at 79,728,403 bp
  • G to A, chromosome 16 at 84,801,602 bp
  • T to C, chromosome 16 at 94,390,283 bp
  • G to T, chromosome 17 at 23,308,034 bp
  • T to A, chromosome 17 at 35,015,726 bp
  • A to G, chromosome 17 at 35,672,723 bp
  • A to T, chromosome 17 at 37,952,071 bp
  • A to T, chromosome 18 at 21,557,972 bp
  • C to T, chromosome 18 at 43,766,754 bp
  • G to A, chromosome 18 at 60,916,651 bp
  • C to T, chromosome 19 at 8,829,827 bp
  • T to C, chromosome 19 at 13,454,521 bp
  • T to A, chromosome 19 at 13,838,279 bp
  • C to T, chromosome 19 at 42,788,957 bp
  • GAGCAGCAGCAGCAGCAGCAGCAGCAGC to GAGCAGCAGCAGCAGCAGCAGCAGC, chromosome 19 at 46,083,155 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4856 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
042467-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.