Strain Name:
C57BL/6J-MtgxR4923Btlr/Mmmh
Stock Number:
042525-MU
Citation ID:
RRID:MMRRC_042525-MU
Other Names:
R4923 (G1), C57BL/6J-MtgxR4923Btlr
Major Collection:

Gene Information

Ncam2
Name: neural cell adhesion molecule 2
Synonyms: R4B12 antigen, RNCAM, Ncam-2, Ocam
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 17968
HGNC: HGNC:7657
Homologene: 3336
Rnf220
Name: ring finger protein 220
Synonyms: 4931406I20Rik, 5730503K05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 66743
Homologene: 10036
Brd4
Name: bromodomain containing 4
Synonyms: WI-11513, MCAP, HUNK1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 57261
Homologene: 136213
Nfya
Name: nuclear transcription factor-Y alpha
Synonyms: Sez10, Cbf-b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 18044
HGNC: HGNC:7804
Homologene: 32114
Kif20b
Name: kinesin family member 20B
Synonyms: magoo, Kif20b, C330014J10Rik, 33cex, N-6 kinesin, Mphosph1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 240641
VEGA: 19
HGNC: HGNC:7212
Homologene: 9418
Recql4
Name: RecQ protein-like 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 79456
VEGA: 15
HGNC: HGNC:9949
Homologene: 3144
Arfgap2
Name: ADP-ribosylation factor GTPase activating protein 2
Synonyms: Zfp289, 2310032E02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 77038
Homologene: 8735
Chka
Name: choline kinase alpha
Synonyms: choline/ethanolamine kinase alpha, Chk, CK/EK-alpha, ChoK, EtnK-alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 12660
HGNC: HGNC:1937
Homologene: 88575
Chic2
Name: cysteine-rich hydrophobic domain 2
Synonyms: BTL, 4930502K01Rik, 1700081B18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 74277
HGNC: HGNC:1935
Homologene: 8105
Focad
Name: focadhesin
Synonyms: BC057079
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230393
Homologene: 9842
Dennd4c
Name: DENN/MADD domain containing 4C
Synonyms: 1700065A05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 329877
Homologene: 23057
Mdn1
Name: midasin AAA ATPase 1
Synonyms: 4833432B22Rik, LOC213784, D4Abb1e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 100019
Homologene: 39689
Xdh
Name: xanthine dehydrogenase
Synonyms: XO, Xox1, xanthine oxidase, Xox-1, Xor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 22436
VEGA: 17
Homologene: 324
Topbp1
Name: topoisomerase (DNA) II binding protein 1
Synonyms: D430026L04Rik, 2810429C13Rik, 1110031N14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235559
Homologene: 38262
Mars1
Name: methionine-tRNA synthetase 1
Synonyms: Mars, MetRS, methionyl-tRNA synthetase, methionine tRNA ligase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216443
HGNC: HGNC:6898
Homologene: 90878
Zfp691
Name: zinc finger protein 691
Synonyms: 6430544H17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 195522
Homologene: 9300
Slc39a2
Name: solute carrier family 39 (zinc transporter), member 2
Synonyms: F730005G13Rik, zip2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 214922
Homologene: 40957
Sos1
Name: SOS Ras/Rac guanine nucleotide exchange factor 1
Synonyms: 4430401P03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 20662
VEGA: 17
Homologene: 4117
Rcn1
Name: reticulocalbin 1
Synonyms: Rcn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 19672
HGNC: HGNC:9934
Homologene: 20637
Ptprc
Name: protein tyrosine phosphatase, receptor type, C
Synonyms: Ly-5, B220, Lyt-4, CD45, T200
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 19264
HGNC: HGNC:9666
Homologene: 2126
Lama5
Name: laminin, alpha 5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 16776
HGNC: HGNC:6485
Homologene: 4060
Ncam1
Name: neural cell adhesion molecule 1
Synonyms: NCAM-140, NCAM-180, CD56, NCAM-120, NCAM-1, NCAM, E-NCAM
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 17967
HGNC: HGNC:7656
Homologene: 40754
Cpsf2
Name: cleavage and polyadenylation specific factor 2
Synonyms: Cpsf, 100kDa, 2610024B04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 51786
VEGA: 12
HGNC: HGNC:2325
Homologene: 6460
Elapor1
Name: endosome-lysosome associated apoptosis and autophagy regulator 1
Synonyms: Iir, 5330417C22Rik, Inceptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229722
Homologene: 23249
Egfl8
Name: EGF-like domain 8
Synonyms: NG3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 81701
Homologene: 36473
D11Wsu47e
Name: DNA segment, Chr 11, Wayne State University 47, expressed
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 276852
Homologene: 9928
Npat
Name: nuclear protein in the AT region
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 244879
HGNC: HGNC:7896
Homologene: 1888
Pros1
Name: protein S (alpha)
Synonyms: protein S
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 19128
HGNC: HGNC:9456
Homologene: 264
Cars
Name: cysteinyl-tRNA synthetase
Synonyms: CA3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 27267
HGNC: HGNC:1493
Homologene: 1328
Hnrnpu
Name: heterogeneous nuclear ribonucleoprotein U
Synonyms: Sp120, scaffold attachment factor A, Hnrpu
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 51810
HGNC: HGNC:5048
Homologene: 22991
Afg3l1
Name: AFG3-like AAA ATPase 1
Synonyms: 3110061K15Rik, 1700047G05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 114896
HGNC: HGNC:314
Homologene: 134198
Clstn1
Name: calsyntenin 1
Synonyms: Cst-1, calsyntenin-1, alcadein alpha, 1810034E21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 65945
Homologene: 8814
Zfp445
Name: zinc finger protein 445
Synonyms: ZNF168
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235682
VEGA: 9
Homologene: 27832
Tmeff2
Name: transmembrane protein with EGF-like and two follistatin-like domains 2
Synonyms: 4832418D20Rik, 7630402F16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 56363
Homologene: 9417
Tmem119
Name: transmembrane protein 119
Synonyms: obif
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231633
Homologene: 17145
Vit
Name: vitrin
Synonyms: 2810429K11Rik, 1700052E02Rik, akhirin, AKH, 1700110E08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 74199
VEGA: 17
Homologene: 24942
Ddr2
Name: discoidin domain receptor family, member 2
Synonyms: Ntrkr3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18214
HGNC: HGNC:2731
Homologene: 68505
Kcnk2
Name: potassium channel, subfamily K, member 2
Synonyms: TREK-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16526
HGNC: HGNC:6277
Homologene: 7794
Chrne
Name: cholinergic receptor, nicotinic, epsilon polypeptide
Synonyms: Acre, AChrepsilon
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 11448
HGNC: HGNC:1966
Homologene: 60
Ttn
Name: titin
Synonyms: 2310057K23Rik, connectin, D830007G01Rik, D330041I19Rik, L56, shru, 1100001C23Rik, 2310036G12Rik, mdm, 2310074I15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Elf3
Name: E74-like factor 3
Synonyms: ESX, jen, ESE-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13710
HGNC: HGNC:3318
Homologene: 3265
Arhgap20
Name: Rho GTPase activating protein 20
Synonyms: A530023E23Rik, 6530403F17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 244867
Homologene: 18938
Trappc14
Name: trafficking protein particle complex 14
Synonyms: Map11, BC037034
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231807
Homologene: 10106
Armc3
Name: armadillo repeat containing 3
Synonyms: 4921513G22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 70882
Homologene: 31589
Xirp2
Name: xin actin-binding repeat containing 2
Synonyms: 2310003D02Rik, Cmya3, myomaxin, mXin beta, A530024P18Rik, 2310008C07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241431
Homologene: 19388
Impg1
Name: interphotoreceptor matrix proteoglycan 1
Synonyms: SPACR, A930015H12Rik, IMP150
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 63859
HGNC: HGNC:6055
Homologene: 1201
Vmn2r61
Name: vomeronasal 2, receptor 61
Synonyms: Gprc2a-rs2, EG637873, Casr-rs2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 637873
Homologene: 129683
Vmn1r179
Name: vomeronasal 1 receptor 179
Synonyms: V1rd17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 404286
Homologene: 134022
Il17ra
Name: interleukin 17 receptor A
Synonyms: VDw217, Il17r
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 16172
HGNC: HGNC:5985
Homologene: 7378
Col6a6
Name: collagen, type VI, alpha 6
Synonyms: E330026B02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 245026
Homologene: 18260
Olfr1245
Name: olfactory receptor 1245
Synonyms: MOR231-12, GA_x6K02T2Q125-51020951-51020028
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258784
Homologene: 121560
Atp11b
Name: ATPase, class VI, type 11B
Synonyms: 1110019I14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 76295
Homologene: 32919
Ccdc39
Name: coiled-coil domain containing 39
Synonyms: b2b1304Clo, D3Ertd789e, prh, 4921507O14Rik, b2b1735Clo, b2b2025.1Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 51938
Homologene: 12149
Ccdc110
Name: coiled-coil domain containing 110
Synonyms: LOC212392
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 212392
Homologene: 17668
Ankhd1
Name: ankyrin repeat and KH domain containing 1
Synonyms: 9130019P20Rik, A530027J04Rik, 4933432B13Rik, 1110004O12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 108857
Homologene: 87006
Etv3
Name: ets variant 3
Synonyms: Pe1, ETS-domain transcriptional repressor, METS
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 27049
HGNC: HGNC:3492
Homologene: 21085
Odad2
Name: outer dynein arm docking complex subunit 2
Synonyms: Armc4, b2b227.1Clo, 4930463I21Rik, b2b643Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 74934
VEGA: 18
Homologene: 9992
Fbll1
Name: fibrillarin-like 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237730
Homologene: 28185
Albfm1
Name: albumin superfamily member 1
Synonyms: 5830473C10Rik, Gm17754, ARG
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 622307
Homologene: 129803
Gnptab
Name: N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
Synonyms: EG432486
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 432486
Homologene: 32576
Pla2r1
Name: phospholipase A2 receptor 1
Synonyms: Pla2g1br, PLA2-I receptor, M-type receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18779
HGNC: HGNC:9042
Homologene: 32016
Fcrla
Name: Fc receptor-like A
Synonyms: Freb1, FREB, FCRL1, mFcrX, Fcrx, mFREB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 98752
Homologene: 13106
Olfr805
Name: olfactory receptor 805
Synonyms: MOR110-4, GA_x6K02T2PULF-11402237-11401278
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 258548
Gabrr1
Name: gamma-aminobutyric acid (GABA) C receptor, subunit rho 1
Synonyms: GABA-C
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 14408
HGNC: HGNC:4090
Homologene: 20470
Osmr
Name: oncostatin M receptor
Synonyms: OSMRB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 18414
HGNC: HGNC:8507
Homologene: 2972
Cgrrf1
Name: cell growth regulator with ring finger domain 1
Synonyms: CGR19, 1810009H17Rik, 1110038G02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 68755
Homologene: 4789
Mdga1
Name: MAM domain containing glycosylphosphatidylinositol anchor 1
Synonyms: 1200011I03Rik, Mamdc3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 74762
Homologene: 17780
Wiz
Name: widely-interspaced zinc finger motifs
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 22404
Homologene: 7997
Aim2
Name: absent in melanoma 2
Synonyms: Ifi210, LOC383619
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 383619
HGNC: HGNC:357
Homologene: 83226
Pde7b
Name: phosphodiesterase 7B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 29863
HGNC: HGNC:8792
Homologene: 32194
Fah
Name: fumarylacetoacetate hydrolase
Synonyms: swst
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 14085
HGNC: HGNC:3579
Homologene: 110
Tec
Name: tec protein tyrosine kinase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 21682
Homologene: 1302
Cyp2j12
Name: cytochrome P450, family 2, subfamily j, polypeptide 12
Synonyms: Cyp2j12-ps, OTTMUSG00000007939
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242546
Homologene: 133195
Ano2
Name: anoctamin 2
Synonyms: Tmem16b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243634
HGNC: HGNC:1183
Homologene: 23221
Lilrb4a
Name: leukocyte immunoglobulin-like receptor, subfamily B, member 4A
Synonyms: HM18, CD85K, ILT3, Lilrb4, Gp49b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 14728
VEGA: 10
HGNC: HGNC:6608
Homologene: 86756
Spam1
Name: sperm adhesion molecule 1
Synonyms: Ph-20
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 20690
Homologene: 7547
Cobll1
Name: Cobl-like 1
Synonyms: Coblr1, D430044D16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 319876
Homologene: 8933
Fnip2
Name: folliculin interacting protein 2
Synonyms: D630023B12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 329679
Homologene: 46417
Lztr1
Name: leucine-zipper-like transcriptional regulator, 1
Synonyms: TCFL2, 1200003E21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 66863
HGNC: HGNC:6742
Homologene: 4925
Vmn2r87
Name: vomeronasal 2, receptor 87
Synonyms: EG625131
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 625131
Homologene: 129606
Vmn1r84
Name: vomeronasal 1 receptor 84
Synonyms: V1rg11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 171267
Homologene: 74328
Itgax
Name: integrin alpha X
Synonyms: CD11C (p150) alpha polypeptide, Cd11c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16411
HGNC: HGNC:6152
Homologene: 55493
Prkcz
Name: protein kinase C, zeta
Synonyms: aPKCzeta, zetaPKC, Pkcz
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 18762
HGNC: HGNC:9412
Homologene: 55681
Nck2
Name: non-catalytic region of tyrosine kinase adaptor protein 2
Synonyms: NCKbeta, 4833426I10Rik, Grb4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 17974
HGNC: HGNC:7665
Homologene: 20794
Cyp21a1
Name: cytochrome P450, family 21, subfamily a, polypeptide 1
Synonyms: Oh21-1, 21-OH, 21OH, 21-hydroxylase, Oh21-1, Cyp21, 21OHA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 13079
Homologene: 68063
Mapk13
Name: mitogen-activated protein kinase 13
Synonyms: p38 delta MAP kinase, Serk4, SAPK4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 26415
HGNC: HGNC:6875
Homologene: 48133
Olfr530
Name: olfactory receptor 530
Synonyms: MOR252-2, GA_x6K02T2PBJ9-42523824-42522901
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258512
Homologene: 128384
Myg1
Name: melanocyte proliferating gene 1
Synonyms: Gamm1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 60315
Homologene: 5853
Tas2r138
Name: taste receptor, type 2, member 138
Synonyms: mt2r31, Tas2r38, T2R138
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 387513
HGNC: HGNC:9584
Homologene: 47976
Skap1
Name: src family associated phosphoprotein 1
Synonyms: 1700091G21Rik, Skap-55
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 78473
Homologene: 2764
Fam189a1
Name: family with sequence similarity 189, member A1
Synonyms: 5730507A09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 70638
Homologene: 77705
C1s2
Name: complement component 1, s subcomponent 2
Synonyms: Gm5077
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 317677
HGNC: HGNC:1247
Homologene: 1314
Slc17a2
Name: solute carrier family 17 (sodium phosphate), member 2
Synonyms: C730032N17Rik, NPT3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 218103
Homologene: 4260
Mup21
Name: major urinary protein 21
Synonyms: Gm11208
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 381531
Homologene: 74304
Akr1c6
Name: aldo-keto reductase family 1, member C6
Synonyms: 3alpha-HSD, estradiol 17-beta-dehydrogenase (A-specific), Akr1c1, Hsd17b5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 83702
HGNC: HGNC:387
Homologene: 84695
Creb3l4
Name: cAMP responsive element binding protein 3-like 4
Synonyms: 5330432F22Rik, mJAL, Tisp40beta, ATCE1, 1700012K17Rik, Tisp40alpha, Tisp40, JAL
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 78284
Homologene: 12693
Krt9
Name: keratin 9
Synonyms: Krt1-9, K9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 107656
HGNC: HGNC:6447
Homologene: 138337
Slc2a10
Name: solute carrier family 2 (facilitated glucose transporter), member 10
Synonyms: Glut10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 170441
Homologene: 38551
Btd
Name: biotinidase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 26363
HGNC: HGNC:1122
Homologene: 37255
Samd13
Name: sterile alpha motif domain containing 13
Synonyms: LOC381481
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Scp2d1
Name: SCP2 sterol-binding domain containing 1
Synonyms: 1700010M22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 66328
Homologene: 11947
Vmn1r227
Name: vomeronasal 1 receptor 227
Synonyms: V1re6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 171229
Gm11695
Name: predicted gene 11695
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 102634708
A430057M04Rik
Name: RIKEN cDNA A430057M04 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 319486
Gm15738
Name: predicted gene 15738
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 102635268
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 43,461,071 bp
  • T to A, chromosome 1 at 50,930,645 bp
  • A to G, chromosome 1 at 135,256,735 bp
  • A to G, chromosome 1 at 138,078,498 bp
  • A to G, chromosome 1 at 169,997,929 bp
  • A to T, chromosome 1 at 170,921,113 bp
  • A to G, chromosome 1 at 173,459,806 bp
  • G to A, chromosome 1 at 178,331,452 bp
  • A to T, chromosome 1 at 189,339,936 bp
  • A to G, chromosome 2 at 19,292,980 bp
  • A to T, chromosome 2 at 60,422,712 bp
  • A to G, chromosome 2 at 65,099,258 bp
  • A to G, chromosome 2 at 67,512,893 bp
  • A to T, chromosome 2 at 76,770,888 bp
  • T to C, chromosome 2 at 89,575,679 bp
  • G to A, chromosome 2 at 91,273,659 bp
  • T to C, chromosome 2 at 105,389,173 bp
  • T to A, chromosome 2 at 144,824,110 bp
  • T to C, chromosome 2 at 165,514,756 bp
  • T to G, chromosome 2 at 180,184,149 bp
  • C to T, chromosome 3 at 33,813,155 bp
  • T to C, chromosome 3 at 35,835,379 bp
  • T to A, chromosome 3 at 79,489,394 bp
  • T to G, chromosome 3 at 87,535,916 bp
  • T to A, chromosome 3 at 90,242,214 bp
  • C to T, chromosome 3 at 108,471,968 bp
  • T to C, chromosome 3 at 146,662,747 bp
  • T to A, chromosome 4 at 32,671,608 bp
  • T to A, chromosome 4 at 33,162,820 bp
  • T to C, chromosome 4 at 62,147,965 bp
  • T to C, chromosome 4 at 86,807,538 bp
  • T to C, chromosome 4 at 88,196,846 bp
  • C to T, chromosome 4 at 96,102,109 bp
  • C to T, chromosome 4 at 117,489,600 bp
  • T to C, chromosome 4 at 119,170,802 bp
  • T to C, chromosome 4 at 149,645,029 bp
  • T to C, chromosome 4 at 155,357,489 bp
  • T to A, chromosome 5 at 72,782,022 bp
  • A to G, chromosome 5 at 75,011,211 bp
  • A to G, chromosome 5 at 90,561,299 bp
  • T to C, chromosome 5 at 113,795,344 bp
  • A to T, chromosome 5 at 138,262,379 bp
  • C to T, chromosome 6 at 24,796,656 bp
  • T to A, chromosome 6 at 40,612,886 bp
  • T to A, chromosome 6 at 120,477,445 bp
  • T to C, chromosome 6 at 124,625,690 bp
  • T to C, chromosome 6 at 125,903,055 bp
  • T to C, chromosome 7 at 12,361,816 bp
  • T to G, chromosome 7 at 23,929,066 bp
  • A to G, chromosome 7 at 42,267,096 bp
  • A to G, chromosome 7 at 64,767,691 bp
  • C to A, chromosome 7 at 84,602,052 bp
  • C to T, chromosome 7 at 128,148,528 bp
  • G to T, chromosome 7 at 140,373,007 bp
  • A to T, chromosome 7 at 143,569,850 bp
  • A to G, chromosome 8 at 45,943,423 bp
  • T to A, chromosome 8 at 123,492,964 bp
  • A to T, chromosome 9 at 49,505,479 bp
  • G to T, chromosome 9 at 51,831,808 bp
  • A to G, chromosome 9 at 53,571,030 bp
  • G to A, chromosome 9 at 80,345,078 bp
  • T to A, chromosome 9 at 80,345,545 bp
  • A to G, chromosome 9 at 103,312,836 bp
  • A to T, chromosome 9 at 105,788,948 bp
  • A to C, chromosome 9 at 122,852,293 bp
  • G to T, chromosome 10 at 20,413,127 bp
  • A to G, chromosome 10 at 51,492,043 bp
  • A to G, chromosome 10 at 88,429,623 bp
  • C to A, chromosome 10 at 127,296,680 bp
  • A to G, chromosome 10 at 129,722,812 bp
  • A to G, chromosome 10 at 130,478,566 bp
  • C to A, chromosome 11 at 35,797,580 bp
  • A to G, chromosome 11 at 70,615,275 bp
  • A to T, chromosome 11 at 96,754,044 bp
  • TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC to TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC, chromosome 11 at 100,189,077 bp
  • C to A, chromosome 11 at 113,688,979 bp
  • G to A, chromosome 11 at 115,462,767 bp
  • T to C, chromosome 12 at 101,981,984 bp
  • T to C, chromosome 13 at 4,454,495 bp
  • G to A, chromosome 13 at 23,819,095 bp
  • A to T, chromosome 14 at 21,848,745 bp
  • T to A, chromosome 14 at 31,662,087 bp
  • T to A, chromosome 14 at 46,846,188 bp
  • G to A, chromosome 14 at 51,895,254 bp
  • T to C, chromosome 15 at 6,842,038 bp
  • G to A, chromosome 15 at 76,710,181 bp
  • A to G, chromosome 15 at 102,331,853 bp
  • T to C, chromosome 16 at 13,384,246 bp
  • T to A, chromosome 16 at 17,515,829 bp
  • T to A, chromosome 16 at 62,903,572 bp
  • C to T, chromosome 16 at 81,589,791 bp
  • C to T, chromosome 17 at 20,735,112 bp
  • C to A, chromosome 17 at 28,778,223 bp
  • C to A, chromosome 17 at 29,838,078 bp
  • A to G, chromosome 17 at 32,199,240 bp
  • C to T, chromosome 17 at 32,361,596 bp
  • T to C, chromosome 17 at 34,614,197 bp
  • G to A, chromosome 17 at 34,803,393 bp
  • T to C, chromosome 17 at 48,400,535 bp
  • C to A, chromosome 17 at 73,924,936 bp
  • T to A, chromosome 17 at 78,586,841 bp
  • T to C, chromosome 17 at 80,434,952 bp
  • C to G, chromosome 18 at 7,181,787 bp
  • A to G, chromosome 18 at 36,589,452 bp
  • A to T, chromosome 19 at 3,892,105 bp
  • A to C, chromosome 19 at 34,941,211 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4923 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042525-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality of this material. We have extensive experience with recovery of mice from cryopreserved sperm and embryos of varying quality, including using techniques such as IVF and ICSI, and are confident that we will have success in most, if not all, cases. However, because of the unknown quality of these frozen samples, we will restrict recovery efforts to two attempts for each order. Subsequent attempts can be performed on a fee-for-service basis, in addition to the standard fees, upon request.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.