Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4923Btlr/Mmmh
Stock Number:
042525-MU
Citation ID:
RRID:MMRRC_042525-MU
Other Names:
R4923 (G1), C57BL/6J-MtgxR4923Btlr
Major Collection:

Strain Information

Ncam2
Name: neural cell adhesion molecule 2
Synonyms: RNCAM, R4B12 antigen, Ncam-2, Ocam
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17968
HGNC: HGNC:7657
Homologene: 3336
Rnf220
Name: ring finger protein 220
Synonyms: 5730503K05Rik, 4931406I20Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66743
Homologene: 10036
Brd4
Name: bromodomain containing 4
Synonyms: MCAP, HUNK1, WI-11513
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 57261
Homologene: 136213
Nfya
Name: nuclear transcription factor-Y alpha
Synonyms: Sez10, Cbf-b
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18044
HGNC: HGNC:7804
Homologene: 32114
Kif20b
Name: kinesin family member 20B
Synonyms: N-6 kinesin, C330014J10Rik, Kif20b, Mphosph1, 33cex, magoo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240641
VEGA: 19
HGNC: HGNC:7212
Homologene: 9418
Recql4
Name: RecQ protein-like 4
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 79456
VEGA: 15
HGNC: HGNC:9949
Homologene: 3144
Arfgap2
Name: ARF GTPase activating protein 2
Synonyms: 2310032E02Rik, Zfp289
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 77038
Homologene: 8735
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 43,461,071 bp
  • T to A, chromosome 1 at 50,930,645 bp
  • A to G, chromosome 1 at 135,256,735 bp
  • A to G, chromosome 1 at 138,078,498 bp
  • A to G, chromosome 1 at 169,997,929 bp
  • A to T, chromosome 1 at 170,921,113 bp
  • A to G, chromosome 1 at 173,459,806 bp
  • G to A, chromosome 1 at 178,331,452 bp
  • A to T, chromosome 1 at 189,339,936 bp
  • A to G, chromosome 2 at 19,292,980 bp
  • A to T, chromosome 2 at 60,422,712 bp
  • A to G, chromosome 2 at 65,099,258 bp
  • A to G, chromosome 2 at 67,512,893 bp
  • A to T, chromosome 2 at 76,770,888 bp
  • T to C, chromosome 2 at 89,575,679 bp
  • G to A, chromosome 2 at 91,273,659 bp
  • T to C, chromosome 2 at 105,389,173 bp
  • T to A, chromosome 2 at 144,824,110 bp
  • T to C, chromosome 2 at 165,514,756 bp
  • T to G, chromosome 2 at 180,184,149 bp
  • C to T, chromosome 3 at 33,813,155 bp
  • T to C, chromosome 3 at 35,835,379 bp
  • T to A, chromosome 3 at 79,489,394 bp
  • T to G, chromosome 3 at 87,535,916 bp
  • T to A, chromosome 3 at 90,242,214 bp
  • C to T, chromosome 3 at 108,471,968 bp
  • T to C, chromosome 3 at 146,662,747 bp
  • T to A, chromosome 4 at 32,671,608 bp
  • T to A, chromosome 4 at 33,162,820 bp
  • T to C, chromosome 4 at 62,147,965 bp
  • T to C, chromosome 4 at 86,807,538 bp
  • T to C, chromosome 4 at 88,196,846 bp
  • C to T, chromosome 4 at 96,102,109 bp
  • C to T, chromosome 4 at 117,489,600 bp
  • T to C, chromosome 4 at 119,170,802 bp
  • T to C, chromosome 4 at 149,645,029 bp
  • T to C, chromosome 4 at 155,357,489 bp
  • T to A, chromosome 5 at 72,782,022 bp
  • A to G, chromosome 5 at 75,011,211 bp
  • A to G, chromosome 5 at 90,561,299 bp
  • T to C, chromosome 5 at 113,795,344 bp
  • A to T, chromosome 5 at 138,262,379 bp
  • C to T, chromosome 6 at 24,796,656 bp
  • T to A, chromosome 6 at 40,612,886 bp
  • T to A, chromosome 6 at 120,477,445 bp
  • T to C, chromosome 6 at 124,625,690 bp
  • T to C, chromosome 6 at 125,903,055 bp
  • T to C, chromosome 7 at 12,361,816 bp
  • T to G, chromosome 7 at 23,929,066 bp
  • A to G, chromosome 7 at 42,267,096 bp
  • A to G, chromosome 7 at 64,767,691 bp
  • C to A, chromosome 7 at 84,602,052 bp
  • C to T, chromosome 7 at 128,148,528 bp
  • G to T, chromosome 7 at 140,373,007 bp
  • A to T, chromosome 7 at 143,569,850 bp
  • A to G, chromosome 8 at 45,943,423 bp
  • T to A, chromosome 8 at 123,492,964 bp
  • A to T, chromosome 9 at 49,505,479 bp
  • G to T, chromosome 9 at 51,831,808 bp
  • A to G, chromosome 9 at 53,571,030 bp
  • G to A, chromosome 9 at 80,345,078 bp
  • T to A, chromosome 9 at 80,345,545 bp
  • A to G, chromosome 9 at 103,312,836 bp
  • A to T, chromosome 9 at 105,788,948 bp
  • A to C, chromosome 9 at 122,852,293 bp
  • G to T, chromosome 10 at 20,413,127 bp
  • A to G, chromosome 10 at 51,492,043 bp
  • A to G, chromosome 10 at 88,429,623 bp
  • C to A, chromosome 10 at 127,296,680 bp
  • A to G, chromosome 10 at 129,722,812 bp
  • A to G, chromosome 10 at 130,478,566 bp
  • C to A, chromosome 11 at 35,797,580 bp
  • A to G, chromosome 11 at 70,615,275 bp
  • A to T, chromosome 11 at 96,754,044 bp
  • TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC to TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC, chromosome 11 at 100,189,077 bp
  • C to A, chromosome 11 at 113,688,979 bp
  • G to A, chromosome 11 at 115,462,767 bp
  • T to C, chromosome 12 at 101,981,984 bp
  • T to C, chromosome 13 at 4,454,495 bp
  • G to A, chromosome 13 at 23,819,095 bp
  • A to T, chromosome 14 at 21,848,745 bp
  • T to A, chromosome 14 at 31,662,087 bp
  • T to A, chromosome 14 at 46,846,188 bp
  • G to A, chromosome 14 at 51,895,254 bp
  • T to C, chromosome 15 at 6,842,038 bp
  • G to A, chromosome 15 at 76,710,181 bp
  • A to G, chromosome 15 at 102,331,853 bp
  • T to C, chromosome 16 at 13,384,246 bp
  • T to A, chromosome 16 at 17,515,829 bp
  • T to A, chromosome 16 at 62,903,572 bp
  • C to T, chromosome 16 at 81,589,791 bp
  • C to T, chromosome 17 at 20,735,112 bp
  • C to A, chromosome 17 at 28,778,223 bp
  • C to A, chromosome 17 at 29,838,078 bp
  • A to G, chromosome 17 at 32,199,240 bp
  • C to T, chromosome 17 at 32,361,596 bp
  • T to C, chromosome 17 at 34,614,197 bp
  • G to A, chromosome 17 at 34,803,393 bp
  • T to C, chromosome 17 at 48,400,535 bp
  • C to A, chromosome 17 at 73,924,936 bp
  • T to A, chromosome 17 at 78,586,841 bp
  • T to C, chromosome 17 at 80,434,952 bp
  • C to G, chromosome 18 at 7,181,787 bp
  • A to G, chromosome 18 at 36,589,452 bp
  • A to T, chromosome 19 at 3,892,105 bp
  • A to C, chromosome 19 at 34,941,211 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4923 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042525-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.