Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5024Btlr/Mmmh
Stock Number:
042615-MU
Citation ID:
RRID:MMRRC_042615-MU
Other Names:
R5024 (G1), C57BL/6J-MtgxR5024Btlr
Major Collection:

Strain Information

Slc12a1
Name: solute carrier family 12, member 1
Synonyms: Nkcc2, mBSC1, D630042G03Rik, urehr3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20495
Homologene: 286
H2-DMa
Name: histocompatibility 2, class II, locus DMa
Synonyms: H2-Ma, H-2Ma, H2-M alpha
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14998
HGNC: HGNC:4934
Homologene: 4464
Slc12a5
Name: solute carrier family 12, member 5
Synonyms: KCC2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 57138
Homologene: 10665
Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Etv1
Name: ets variant 1
Synonyms: ER81, Etsrp81
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 14009
HGNC: HGNC:3490
Homologene: 3636
Kcns2
Name: K+ voltage-gated channel, subfamily S, 2
Synonyms: Kv9.2, E130006J24Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16539
VEGA: 15
HGNC: HGNC:6301
Homologene: 22465
Bahcc1
Name: BAH domain and coiled-coil containing 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268515
Homologene: 129585
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 52,082,570 bp
  • A to T, chromosome 1 at 88,275,050 bp
  • G to T, chromosome 1 at 89,145,595 bp
  • A to G, chromosome 1 at 132,490,488 bp
  • G to T, chromosome 1 at 134,955,733 bp
  • T to A, chromosome 1 at 150,680,688 bp
  • A to G, chromosome 1 at 162,920,639 bp
  • T to A, chromosome 1 at 168,183,589 bp
  • T to G, chromosome 2 at 32,673,392 bp
  • A to T, chromosome 2 at 76,948,425 bp
  • A to C, chromosome 2 at 77,054,703 bp
  • G to T, chromosome 2 at 86,146,533 bp
  • C to T, chromosome 2 at 86,423,461 bp
  • A to G, chromosome 2 at 125,166,137 bp
  • C to T, chromosome 2 at 164,997,137 bp
  • C to T, chromosome 3 at 33,813,155 bp
  • T to A, chromosome 3 at 54,194,796 bp
  • T to C, chromosome 3 at 100,154,936 bp
  • C to T, chromosome 4 at 4,010,365 bp
  • T to A, chromosome 4 at 14,532,572 bp
  • T to A, chromosome 4 at 14,826,293 bp
  • T to A, chromosome 4 at 43,659,674 bp
  • C to T, chromosome 4 at 48,241,296 bp
  • T to A, chromosome 4 at 74,098,144 bp
  • C to A, chromosome 4 at 94,951,016 bp
  • T to G, chromosome 4 at 98,785,661 bp
  • A to C, chromosome 4 at 108,691,669 bp
  • A to G, chromosome 4 at 128,321,348 bp
  • C to A, chromosome 4 at 144,373,308 bp
  • G to A, chromosome 4 at 149,635,294 bp
  • T to C, chromosome 5 at 21,399,614 bp
  • T to C, chromosome 5 at 30,019,514 bp
  • A to G, chromosome 5 at 104,522,258 bp
  • A to G, chromosome 5 at 129,171,895 bp
  • A to T, chromosome 5 at 137,461,893 bp
  • A to T, chromosome 6 at 29,374,519 bp
  • A to G, chromosome 6 at 83,028,358 bp
  • G to A, chromosome 6 at 83,674,319 bp
  • C to T, chromosome 6 at 127,471,636 bp
  • G to A, chromosome 7 at 14,580,975 bp
  • A to G, chromosome 7 at 17,910,682 bp
  • A to G, chromosome 7 at 29,148,407 bp
  • G to A, chromosome 7 at 30,292,219 bp
  • A to C, chromosome 7 at 30,715,864 bp
  • A to G, chromosome 7 at 41,864,322 bp
  • G to A, chromosome 7 at 43,692,077 bp
  • G to T, chromosome 7 at 45,259,966 bp
  • G to A, chromosome 7 at 45,406,591 bp
  • A to T, chromosome 7 at 86,694,881 bp
  • A to G, chromosome 7 at 126,864,489 bp
  • G to T, chromosome 7 at 128,248,217 bp
  • A to G, chromosome 7 at 134,918,478 bp
  • A to G, chromosome 9 at 21,237,226 bp
  • T to C, chromosome 9 at 40,149,343 bp
  • A to T, chromosome 9 at 66,470,326 bp
  • ACACGCACGCACGCACGCACGCACGCACGCACGCACGCAC to ACACGCACGCACGCACGCACGCACGCACGCACGCACGCACGCAC, chromosome 9 at 108,448,985 bp
  • T to C, chromosome 9 at 109,179,335 bp
  • A to T, chromosome 9 at 109,663,374 bp
  • T to C, chromosome 9 at 110,483,093 bp
  • T to A, chromosome 9 at 124,350,155 bp
  • C to A, chromosome 10 at 83,583,336 bp
  • G to T, chromosome 10 at 86,656,587 bp
  • C to T, chromosome 10 at 127,286,441 bp
  • T to A, chromosome 11 at 58,720,950 bp
  • A to T, chromosome 11 at 60,797,479 bp
  • T to A, chromosome 11 at 120,289,835 bp
  • A to C, chromosome 12 at 4,937,534 bp
  • A to T, chromosome 12 at 16,554,006 bp
  • A to G, chromosome 12 at 31,453,908 bp
  • T to A, chromosome 12 at 38,854,234 bp
  • C to T, chromosome 12 at 53,142,562 bp
  • T to C, chromosome 13 at 13,634,404 bp
  • A to T, chromosome 13 at 43,434,855 bp
  • T to C, chromosome 14 at 59,258,483 bp
  • A to G, chromosome 14 at 73,239,369 bp
  • T to C, chromosome 14 at 122,941,302 bp
  • A to T, chromosome 15 at 34,839,537 bp
  • T to C, chromosome 15 at 76,005,142 bp
  • A to T, chromosome 15 at 83,587,113 bp
  • G to T, chromosome 16 at 16,863,793 bp
  • T to A, chromosome 16 at 56,260,100 bp
  • T to C, chromosome 16 at 90,876,193 bp
  • A to C, chromosome 17 at 28,351,995 bp
  • A to T, chromosome 17 at 30,736,096 bp
  • A to T, chromosome 17 at 34,138,487 bp
  • A to C, chromosome 17 at 42,805,345 bp
  • T to C, chromosome 18 at 7,088,555 bp
  • C to T, chromosome 18 at 34,641,582 bp
  • A to C, chromosome 18 at 61,506,440 bp
  • A to T, chromosome 18 at 74,716,034 bp
  • G to A, chromosome 19 at 6,083,992 bp
  • C to T, chromosome 19 at 26,887,775 bp
  • A to G, chromosome 19 at 44,301,271 bp
  • A to G, chromosome Y at 10,641,303 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5024 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042615-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.