Strain Name:
C57BL/6J-MtgxR5024Btlr/Mmmh
Stock Number:
042615-MU
Citation ID:
RRID:MMRRC_042615-MU
Other Names:
R5024 (G1), C57BL/6J-MtgxR5024Btlr
Major Collection:

Strain Information

Slc12a1
Name: solute carrier family 12, member 1
Synonyms: Nkcc2, mBSC1, D630042G03Rik, urehr3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20495
Homologene: 286
H2-DMa
Name: histocompatibility 2, class II, locus DMa
Synonyms: H2-Ma, H-2Ma, H2-M alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 14998
HGNC: HGNC:4934
Homologene: 4464
Slc12a5
Name: solute carrier family 12, member 5
Synonyms: KCC2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 57138
Homologene: 10665
Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Etv1
Name: ets variant 1
Synonyms: ER81, Etsrp81
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 14009
HGNC: HGNC:3490
Homologene: 3636
Kcns2
Name: K+ voltage-gated channel, subfamily S, 2
Synonyms: Kv9.2, E130006J24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 16539
VEGA: 15
HGNC: HGNC:6301
Homologene: 22465
Bahcc1
Name: BAH domain and coiled-coil containing 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 268515
Homologene: 129585
Cd2ap
Name: CD2-associated protein
Synonyms: METS-1, Mets1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 12488
VEGA: 17
Homologene: 7663
Igll1
Name: immunoglobulin lambda-like polypeptide 1
Synonyms: Igll, Lambda 5, Igl-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 16136
Homologene: 131669
Shmt1
Name: serine hydroxymethyltransferase 1 (soluble)
Synonyms: mshmt2, mshmt1, mshmt, Shmt
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 20425
Homologene: 3074
Mysm1
Name: myb-like, SWIRM and MPN domains 1
Synonyms: C530050H10Rik, C130067A03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 320713
Homologene: 66204
Washc4
Name: WASH complex subunit 4
Synonyms: A230046K03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 319277
VEGA: 10
Homologene: 123926
Erp44
Name: endoplasmic reticulum protein 44
Synonyms: 1110001E24Rik, Txndc4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 76299
Homologene: 12638
Ranbp9
Name: RAN binding protein 9
Synonyms: IBAP-1, RanBPM
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 56705
VEGA: 13
Homologene: 38057
Rbbp5
Name: retinoblastoma binding protein 5, histone lysine methyltransferase complex subunit
Synonyms: 4933411J24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 213464
HGNC: HGNC:9888
Homologene: 3709
Wdr3
Name: WD repeat domain 3
Synonyms: D030020G18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 269470
Homologene: 4937
Herc1
Name: HECT and RLD domain containing E3 ubiquitin protein ligase family member 1
Synonyms: D130015N03Rik, 2810449H11Rik, tbl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235439
HGNC: HGNC:4867
Homologene: 31207
Lpar6
Name: lysophosphatidic acid receptor 6
Synonyms: 2610302I02Rik, P2y5, P2ry5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 67168
Homologene: 55925
Fam83h
Name: family with sequence similarity 83, member H
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 105732
VEGA: 15
Homologene: 15890
Ccdc141
Name: coiled-coil domain containing 141
Synonyms: ENSMUSG00000075261, CAMDI, 2610301F02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 545428
Homologene: 52149
Otud6b
Name: OTU domain containing 6B
Synonyms: 2600013N14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 72201
Homologene: 6064
Hjurp
Name: Holliday junction recognition protein
Synonyms: C330011F01Rik, A730008H23Rik, 6430706D22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 381280
Homologene: 10184
Lpin1
Name: lipin 1
Synonyms: Lipin1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 14245
VEGA: 12
Homologene: 9266
Kank4
Name: KN motif and ankyrin repeat domains 4
Synonyms: Ankrd38
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242553
Homologene: 18244
Eva1c
Name: eva-1 homolog C
Synonyms: 1700092M14Rik, Fam176c, 4931408A02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 70967
Homologene: 14383
Eng
Name: endoglin
Synonyms: CD105, Endo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 13805
HGNC: HGNC:3349
Homologene: 92
Pbx1
Name: pre B cell leukemia homeobox 1
Synonyms: Pbx-1, D230003C07Rik, 2310056B04Rik, Pbx1a, Pbx1b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18514
HGNC: HGNC:8632
Homologene: 20574
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, P1-Loop, Dnahc8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Cdc23
Name: CDC23 cell division cycle 23
Synonyms: D18Ertd243e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 52563
HGNC: HGNC:1724
Homologene: 3426
M1ap
Name: meiosis 1 associated protein
Synonyms: D6Mm5e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 110958
Homologene: 13210
Clstn1
Name: calsyntenin 1
Synonyms: calsyntenin-1, Cst-1, 1810034E21Rik, alcadein alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 65945
Homologene: 8814
Parp11
Name: poly (ADP-ribose) polymerase family, member 11
Synonyms: HIN1L, 5330431N24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 101187
HGNC: HGNC:1186
Homologene: 10680
Atad2b
Name: ATPase family, AAA domain containing 2B
Synonyms: 1110014E10Rik, D530031C13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 320817
VEGA: 12
Homologene: 86351
Cd207
Name: CD207 antigen
Synonyms: Langerin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 246278
Homologene: 9252
Ppp1r12b
Name: protein phosphatase 1, regulatory subunit 12B
Synonyms: 1810037O03Rik, 9530009M10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 329251
HGNC: HGNC:7619
Homologene: 135710
Atp4a
Name: ATPase, H+/K+ exchanging, gastric, alpha polypeptide
Synonyms: H+K+-transporting alpha 1, H+/K+-ATPase alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 11944
HGNC: HGNC:819
Homologene: 68081
Adgrd1
Name: adhesion G protein-coupled receptor D1
Synonyms: E230012M21Rik, Gpr133
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 243277
Homologene: 34616
Zfpl1
Name: zinc finger like protein 1
Synonyms: 1500015B20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 81909
Homologene: 4935
Akap6
Name: A kinase anchor protein 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 238161
VEGA: 12
HGNC: HGNC:376
Homologene: 3157
Scd2
Name: stearoyl-Coenzyme A desaturase 2
Synonyms: Scd-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 20250
VEGA: 19
Homologene: 136612
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, D830007G01Rik, shru
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 22138
Homologene: 130650
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 545370
Homologene: 23741
Zfyve9
Name: zinc finger, FYVE domain containing 9
Synonyms: Madhip
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 230597
HGNC: HGNC:6775
Homologene: 3527
Stat4
Name: signal transducer and activator of transcription 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20849
Homologene: 20679
Zan
Name: zonadhesin
Synonyms: Zan
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 22635
Homologene: 124417
Kif9
Name: kinesin family member 9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 16578
Homologene: 65620
Mbd6
Name: methyl-CpG binding domain protein 6
Synonyms: D10Wsu93e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 110962
Homologene: 14171
Ccdc39
Name: coiled-coil domain containing 39
Synonyms: 4921507O14Rik, D3Ertd789e, b2b1735Clo, b2b1304Clo, b2b2025.1Clo, prh
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 51938
Homologene: 12149
Ccdc146
Name: coiled-coil domain containing 146
Synonyms: 4930528G09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 75172
Homologene: 67159
Impg2
Name: interphotoreceptor matrix proteoglycan 2
Synonyms: PG10.2, IPM200, Spacrcan
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 224224
Homologene: 9439
Odad2
Name: outer dynein arm docking complex subunit 2
Synonyms: 4930463I21Rik, Armc4, b2b227.1Clo, b2b643Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 74934
VEGA: 18
Homologene: 9992
Ceacam23
Name: CEA cell adhesion moleculen23
Synonyms: Gm5155
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 381852
Homologene: 115938
Myo5b
Name: myosin VB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 17919
HGNC: HGNC:7603
Homologene: 49481
Rasgrp4
Name: RAS guanyl releasing protein 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233046
Homologene: 15635
Csmd2
Name: CUB and Sushi multiple domains 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 329942
Homologene: 89034
Tgfb1i1
Name: transforming growth factor beta 1 induced transcript 1
Synonyms: TSC-5, hic-5, ARA55
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 21804
Homologene: 7572
Hirip3
Name: HIRA interacting protein 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233876
HGNC: HGNC:4917
Homologene: 18218
Sh3bp4
Name: SH3-domain binding protein 4
Synonyms: BOG25
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 98402
Homologene: 8726
Vmn2r58
Name: vomeronasal 2, receptor 58
Synonyms: EG628422
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 628422
Clip3
Name: CAP-GLY domain containing linker protein 3
Synonyms: 1500005P14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 76686
Homologene: 9176
Slc26a7
Name: solute carrier family 26, member 7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 208890
Homologene: 13770
Or8j3c
Name: olfactory receptor family 8 subfamily J member 3C
Synonyms: GA_x6K02T2Q125-47892992-47892045, MOR185-1, Olfr1062
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 259082
Homologene: 83135
Or14c39
Name: olfactory receptor family 14 subfamily C member 39
Synonyms: GA_x6K02T2NHDJ-9425121-9424195, MOR220-2, Olfr292
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258613
Homologene: 115526
Fbxw13
Name: F-box and WD-40 domain protein 13
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 211305
Homologene: 110776
Klk14
Name: kallikrein related-peptidase 14
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 317653
HGNC: HGNC:6362
Homologene: 69348
Thoc2l
Name: THO complex subunit 2-like
Synonyms: Gm3179, BC005561
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100042165
Calu
Name: calumenin
Synonyms: 9530075H20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 12321
HGNC: HGNC:1458
Homologene: 936
Tmtc4
Name: transmembrane and tetratricopeptide repeat containing 4
Synonyms: 5730419O14Rik, 4930403J22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 70551
Homologene: 32796
Kcna7
Name: potassium voltage-gated channel, shaker-related subfamily, member 7
Synonyms: Kv1.7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 16495
HGNC: HGNC:6226
Homologene: 7791
Sdr16c5
Name: short chain dehydrogenase/reductase family 16C, member 5
Synonyms: Scdr9, Rdhe2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242285
Homologene: 15039
Or5al6
Name: olfactory receptor family 5 subfamily AL member 6
Synonyms: GA_x6K02T2Q125-47615732-47614791, MOR185-12, Olfr1040
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 404323
Homologene: 79382
Ttll12
Name: tubulin tyrosine ligase-like family, member 12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 223723
Homologene: 9036
Slc26a3
Name: solute carrier family 26, member 3
Synonyms: Dra, 9030623B18Rik, 9130013M11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 13487
HGNC: HGNC:3018
Homologene: 55435
Trpc4
Name: transient receptor potential cation channel, subfamily C, member 4
Synonyms: CCE1, Trp4, STRPC4, Trrp4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 22066
Homologene: 22955
Klhdc8b
Name: kelch domain containing 8B
Synonyms: 4931406O17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 78267
Homologene: 45463
Insyn2a
Name: inhibitory synaptic factor 2A
Synonyms: B830028B13Rik, Fam196a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 627214
Homologene: 85469
Tmem225
Name: transmembrane protein 225
Synonyms: 1700030E15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 75667
VEGA: 9
Homologene: 52854
Nlrp4g
Name: NLR family, pyrin domain containing 4G
Synonyms: nalp4g
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235779
VEGA: 9
Or2ak5
Name: olfactory receptor family 2 subfamily AK member 5
Synonyms: GA_x6K02T2NKPP-692816-693736, MOR285-1, Olfr318
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 258494
Homologene: 133825
Arhgef37
Name: Rho guanine nucleotide exchange factor 37
Synonyms: 4933429F08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 328967
VEGA: 18
Homologene: 28467
Frmd3
Name: FERM domain containing 3
Synonyms: EPB41L4O, P410, 4.1O, 9430066I12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242506
Homologene: 16012
Fmo6
Name: flavin containing monooxygenase 6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226565
Homologene: 68130
Tulp1
Name: tubby like protein 1
Synonyms: Tulp1l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 22157
Homologene: 2491
Gm5174
Name: predicted gene 5174
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 382395
VEGA: 10
Homologene: 141143
Fam221b
Name: family with sequence similarity 221, member B
Synonyms: 4930412F15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 242408
Homologene: 52184
Keap1
Name: kelch-like ECH-associated protein 1
Synonyms: ring canal protein, INrf2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 50868
Homologene: 8184
Phf11
Name: PHD finger protein 11
Synonyms: Phf11-ps, Gm6904
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 628693
VEGA: 14
Il6
Name: interleukin 6
Synonyms: Il-6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 16193
HGNC: HGNC:6018
Homologene: 502
Gm20775
Name: predicted gene, 20775
Type: Gene
Species: Mus musculus (mouse)
Chromosome: Y
NCBI: 665550
Nlrp5-ps
Name: NLR family, pyrin domain containing 5, pseudogene
Synonyms: Gm18756
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 100417675
Fbxw25
Name: F-box and WD-40 domain protein 25
Synonyms: E330001B16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 546160
Slc6a16
Name: solute carrier family 6, member 16
Synonyms: LOC381884
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 381884
Homologene: 49366
Gm815
Name: predicted gene 815
Synonyms: LOC329047
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 329047
VEGA: 19
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 52,082,570 bp
  • A to T, chromosome 1 at 88,275,050 bp
  • G to T, chromosome 1 at 89,145,595 bp
  • A to G, chromosome 1 at 132,490,488 bp
  • G to T, chromosome 1 at 134,955,733 bp
  • T to A, chromosome 1 at 150,680,688 bp
  • A to G, chromosome 1 at 162,920,639 bp
  • T to A, chromosome 1 at 168,183,589 bp
  • T to G, chromosome 2 at 32,673,392 bp
  • A to T, chromosome 2 at 76,948,425 bp
  • A to C, chromosome 2 at 77,054,703 bp
  • G to T, chromosome 2 at 86,146,533 bp
  • C to T, chromosome 2 at 86,423,461 bp
  • A to G, chromosome 2 at 125,166,137 bp
  • C to T, chromosome 2 at 164,997,137 bp
  • C to T, chromosome 3 at 33,813,155 bp
  • T to A, chromosome 3 at 54,194,796 bp
  • T to C, chromosome 3 at 100,154,936 bp
  • C to T, chromosome 4 at 4,010,365 bp
  • T to A, chromosome 4 at 14,532,572 bp
  • T to A, chromosome 4 at 14,826,293 bp
  • T to A, chromosome 4 at 43,659,674 bp
  • C to T, chromosome 4 at 48,241,296 bp
  • T to A, chromosome 4 at 74,098,144 bp
  • C to A, chromosome 4 at 94,951,016 bp
  • T to G, chromosome 4 at 98,785,661 bp
  • A to C, chromosome 4 at 108,691,669 bp
  • A to G, chromosome 4 at 128,321,348 bp
  • C to A, chromosome 4 at 144,373,308 bp
  • G to A, chromosome 4 at 149,635,294 bp
  • T to C, chromosome 5 at 21,399,614 bp
  • T to C, chromosome 5 at 30,019,514 bp
  • A to G, chromosome 5 at 104,522,258 bp
  • A to G, chromosome 5 at 129,171,895 bp
  • A to T, chromosome 5 at 137,461,893 bp
  • A to T, chromosome 6 at 29,374,519 bp
  • A to G, chromosome 6 at 83,028,358 bp
  • G to A, chromosome 6 at 83,674,319 bp
  • C to T, chromosome 6 at 127,471,636 bp
  • G to A, chromosome 7 at 14,580,975 bp
  • A to G, chromosome 7 at 17,910,682 bp
  • A to G, chromosome 7 at 29,148,407 bp
  • G to A, chromosome 7 at 30,292,219 bp
  • A to C, chromosome 7 at 30,715,864 bp
  • A to G, chromosome 7 at 41,864,322 bp
  • G to A, chromosome 7 at 43,692,077 bp
  • G to T, chromosome 7 at 45,259,966 bp
  • G to A, chromosome 7 at 45,406,591 bp
  • A to T, chromosome 7 at 86,694,881 bp
  • A to G, chromosome 7 at 126,864,489 bp
  • G to T, chromosome 7 at 128,248,217 bp
  • A to G, chromosome 7 at 134,918,478 bp
  • A to G, chromosome 9 at 21,237,226 bp
  • T to C, chromosome 9 at 40,149,343 bp
  • A to T, chromosome 9 at 66,470,326 bp
  • ACACGCACGCACGCACGCACGCACGCACGCACGCACGCAC to ACACGCACGCACGCACGCACGCACGCACGCACGCACGCACGCAC, chromosome 9 at 108,448,985 bp
  • T to C, chromosome 9 at 109,179,335 bp
  • A to T, chromosome 9 at 109,663,374 bp
  • T to C, chromosome 9 at 110,483,093 bp
  • T to A, chromosome 9 at 124,350,155 bp
  • C to A, chromosome 10 at 83,583,336 bp
  • G to T, chromosome 10 at 86,656,587 bp
  • C to T, chromosome 10 at 127,286,441 bp
  • T to A, chromosome 11 at 58,720,950 bp
  • A to T, chromosome 11 at 60,797,479 bp
  • T to A, chromosome 11 at 120,289,835 bp
  • A to C, chromosome 12 at 4,937,534 bp
  • A to T, chromosome 12 at 16,554,006 bp
  • A to G, chromosome 12 at 31,453,908 bp
  • T to A, chromosome 12 at 38,854,234 bp
  • C to T, chromosome 12 at 53,142,562 bp
  • T to C, chromosome 13 at 13,634,404 bp
  • A to T, chromosome 13 at 43,434,855 bp
  • T to C, chromosome 14 at 59,258,483 bp
  • A to G, chromosome 14 at 73,239,369 bp
  • T to C, chromosome 14 at 122,941,302 bp
  • A to T, chromosome 15 at 34,839,537 bp
  • T to C, chromosome 15 at 76,005,142 bp
  • A to T, chromosome 15 at 83,587,113 bp
  • G to T, chromosome 16 at 16,863,793 bp
  • T to A, chromosome 16 at 56,260,100 bp
  • T to C, chromosome 16 at 90,876,193 bp
  • A to C, chromosome 17 at 28,351,995 bp
  • A to T, chromosome 17 at 30,736,096 bp
  • A to T, chromosome 17 at 34,138,487 bp
  • A to C, chromosome 17 at 42,805,345 bp
  • T to C, chromosome 18 at 7,088,555 bp
  • C to T, chromosome 18 at 34,641,582 bp
  • A to C, chromosome 18 at 61,506,440 bp
  • A to T, chromosome 18 at 74,716,034 bp
  • G to A, chromosome 19 at 6,083,992 bp
  • C to T, chromosome 19 at 26,887,775 bp
  • A to G, chromosome 19 at 44,301,271 bp
  • A to G, chromosome Y at 10,641,303 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5024 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042615-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.