Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5261Btlr/Mmmh
Stock Number:
042830-MU
Citation ID:
RRID:MMRRC_042830-MU
Other Names:
R5261 (G1), C57BL/6J-MtgxR5261Btlr
Major Collection:

Strain Information

Trmt9b
Name: tRNA methyltransferase 9B
Synonyms: 6430573F11Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 319582
Homologene: 35306
D630045J12Rik
Name: RIKEN cDNA D630045J12 gene
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330286
Homologene: 19782
Xrn1
Name: 5'-3' exoribonuclease 1
Synonyms: mXrn1, Dhm2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 24127
Homologene: 5894
Ambra1
Name: autophagy/beclin 1 regulator 1
Synonyms: 2310079H06Rik, D030051N19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228361
Homologene: 18204
Sel1l
Name: sel-1 suppressor of lin-12-like (C. elegans)
Synonyms: Sel1h
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20338
Homologene: 31286
Ints9
Name: integrator complex subunit 9
Synonyms: D14Ertd231e
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 210925
VEGA: 14
Homologene: 10096
R3hdm2
Name: R3H domain containing 2
Synonyms: 1300003K24Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71750
Homologene: 8954
Pdcd11
Name: programmed cell death 11
Synonyms: ALG-4, 1110021I22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18572
VEGA: 19
Homologene: 74968
Zfp35
Name: zinc finger protein 35
Synonyms: Zfp-35
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 22694
Homologene: 133081
Srsf1
Name: serine and arginine-rich splicing factor 1
Synonyms: 1110054N12Rik, 6330415C05Rik, 5730507C05Rik, Sfrs1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 110809
Homologene: 31411
Umps
Name: uridine monophosphate synthetase
Synonyms: 1700095D23Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 22247
Homologene: 319
Socs2
Name: suppressor of cytokine signaling 2
Synonyms: SOCS-2, cytokine-inducible SH2 protein 2, STAT-induced STAT inhibitor 2, SSI-2, CIS2, JAB, Cish2, D130043N08Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216233
Homologene: 2880
Prmt5
Name: protein arginine N-methyltransferase 5
Synonyms: Jbp1, Jak-binding protein 1, Skb1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 27374
Homologene: 4454
Brd3
Name: bromodomain containing 3
Synonyms: RINGL3, ORFX, 2410084F24Rik, Fsrg2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67382
HGNC: HGNC:1104
Homologene: 81801
Trap1
Name: TNF receptor-associated protein 1
Synonyms: HSP75, 2410002K23Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 68015
Homologene: 9457
Vps51
Name: VPS51 GARP complex subunit
Synonyms: 3110057M17Rik, 1110014N23Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 68505
HGNC: HGNC:1172
Homologene: 34675
Cep152
Name: centrosomal protein 152
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99100
Homologene: 37159
Khdc3
Name: KH domain containing 3, subcortical maternal complex member
Synonyms: ecat1, FILIA, 2410004A20Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66991
Homologene: 49842
Pik3ap1
Name: phosphoinositide-3-kinase adaptor protein 1
Synonyms: BCAP, 1810044J04Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 83490
VEGA: 19
Homologene: 12848
Hspa1b
Name: heat shock protein 1B
Synonyms: hsp68, Hsp70.1, Hsp70-1, HSP70B1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15511
HGNC: HGNC:5233
Homologene: 133785
Amfr
Name: autocrine motility factor receptor
Synonyms: gp78
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23802
HGNC: HGNC:463
Homologene: 888
Slc45a2
Name: solute carrier family 45, member 2
Synonyms: Dbr, bls, Aim1, Aim-1, dominant brown, blanc-sale, Matp, Oca4
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 22293
Homologene: 9412
Enpep
Name: glutamyl aminopeptidase
Synonyms: Bp-1/6C3, APA, Ly-51, Ly51, 6030431M22Rik, aminopeptidase-A
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 13809
HGNC: HGNC:3355
Homologene: 68216
Vmn1r28
Name: vomeronasal 1 receptor 28
Synonyms: V1rc25
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171198
Homologene: 138094
Slc35f4
Name: solute carrier family 35, member F4
Synonyms: 4930550L21Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 75288
Homologene: 45939
Snrk
Name: SNF related kinase
Synonyms: SNRK, 2010012F07Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20623
Homologene: 9797
Zfp282
Name: zinc finger protein 282
Synonyms: HUB1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101095
Homologene: 2647
Pcdh10
Name: protocadherin 10
Synonyms: 6430703F07Rik, 6430521D13Rik, OL-pc, Olpc
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18526
Homologene: 74967
Slc3a1
Name: solute carrier family 3, member 1
Synonyms: NTAA, D2H
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20532
VEGA: 17
Homologene: 37289
Gpr142
Name: G protein-coupled receptor 142
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217302
Homologene: 18770
Rev3l
Name: REV3 like, DNA directed polymerase zeta catalytic subunit
Synonyms: Sez4, Rev
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19714
HGNC: HGNC:9968
Homologene: 48147
Gtf2ird2
Name: GTF2I repeat domain containing 2
Synonyms: 1700012P16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 114674
Homologene: 24941
Otogl
Name: otogelin-like
Synonyms: Gm6924
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 628870
Homologene: 46008
Slco1c1
Name: solute carrier organic anion transporter family, member 1c1
Synonyms: OATP-F, Slc21a14
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 58807
Homologene: 23008
Palmd
Name: palmdelphin
Synonyms: PALML, 4631423C22Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 114301
Homologene: 9804
Vsig10l
Name: V-set and immunoglobulin domain containing 10 like
Synonyms: 2210412E05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75690
Homologene: 35386
Cd96
Name: CD96 antigen
Synonyms: Tactile, 1700109I12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 84544
Homologene: 68489
Gucy1b2
Name: guanylate cyclase 1, soluble, beta 2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239134
HGNC: HGNC:4686
Homologene: 136630
Pycr1
Name: pyrroline-5-carboxylate reductase 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 209027
HGNC: HGNC:9721
Homologene: 56002
Or5ak25
Name: olfactory receptor family 5 subfamily AK member 25
Synonyms: GA_x6K02T2Q125-46915844-46914897, MOR203-3, Olfr995
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258426
Homologene: 105170
Map2k1
Name: mitogen-activated protein kinase kinase 1
Synonyms: MAP kinase kinase 1, Prkmk1, Mek1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 26395
HGNC: HGNC:6840
Homologene: 2063
Ky
Name: kyphoscoliosis peptidase
Synonyms: D9Mgc44e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 16716
Homologene: 11506
Papolb
Name: poly (A) polymerase beta (testis specific)
Synonyms: Papt, TPAP, Plap-ps, Papola-ps
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56522
Homologene: 121622
Extl2
Name: exostosin-like glycosyltransferase 2
Synonyms: 3000001D04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 58193
HGNC: HGNC:3516
Homologene: 1102
Slx1b
Name: SLX1 structure-specific endonuclease subunit homolog B (S. cerevisiae)
Synonyms: 4833422P03Rik, 2410170E21Rik, 1110030E23Rik, Giyd2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75764
Homologene: 11434
6820408C15Rik
Name: RIKEN cDNA 6820408C15 gene
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228778
Homologene: 51916
Or2t47
Name: olfactory receptor family 2 subfamily T member 47
Synonyms: GA_x6K02T2NKPP-873285-874217, MOR275-2, Olfr328
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258495
Homologene: 133015
Or13a18
Name: olfactory receptor family 13 subfamily A member 18
Synonyms: IF5, ID12, IB7, MOR253-8, GA_x6K02T2PBJ9-42759973-42760905, Olfr46
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18345
Homologene: 110491
Samd1
Name: sterile alpha motif domain containing 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 666704
Homologene: 124206
Stox1
Name: storkhead box 1
Synonyms: 4732470K04Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216021
Homologene: 17649
Asphd1
Name: aspartate beta-hydroxylase domain containing 1
Synonyms: A830007L07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233879
Gm24157
Name: predicted gene, 24157
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Trav7-3
Name: T cell receptor alpha variable 7-3
Synonyms: Gm13946
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 547420
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 2 at 13,574,832 bp
  • C to A, chromosome 2 at 27,463,919 bp
  • A to G, chromosome 2 at 32,304,154 bp
  • A to G, chromosome 2 at 85,438,897 bp
  • G to A, chromosome 2 at 91,885,606 bp
  • T to A, chromosome 2 at 125,564,205 bp
  • C to G, chromosome 2 at 152,440,857 bp
  • G to A, chromosome 3 at 45,381,812 bp
  • A to T, chromosome 3 at 94,639,405 bp
  • G to A, chromosome 3 at 116,027,364 bp
  • T to C, chromosome 3 at 116,923,360 bp
  • T to G, chromosome 3 at 129,305,426 bp
  • A to G, chromosome 4 at 132,499,306 bp
  • C to T, chromosome 5 at 32,938,291 bp
  • A to G, chromosome 5 at 134,216,219 bp
  • C to G, chromosome 5 at 142,529,654 bp
  • A to T, chromosome 6 at 38,194,620 bp
  • A to G, chromosome 6 at 47,897,890 bp
  • C to A, chromosome 6 at 58,265,539 bp
  • T to A, chromosome 6 at 70,960,516 bp
  • T to C, chromosome 6 at 141,546,776 bp
  • T to A, chromosome 7 at 43,470,850 bp
  • G to T, chromosome 7 at 126,700,644 bp
  • C to A, chromosome 7 at 126,946,115 bp
  • A to C, chromosome 7 at 140,610,663 bp
  • T to C, chromosome 8 at 36,511,924 bp
  • CGAGGAGGAGGAGGAGGAGGA to CGAGGAGGAGGAGGAGGA, chromosome 8 at 83,998,996 bp
  • T to A, chromosome 8 at 93,976,170 bp
  • T to A, chromosome 9 at 64,191,561 bp
  • T to G, chromosome 9 at 73,103,486 bp
  • A to G, chromosome 9 at 96,045,543 bp
  • A to G, chromosome 9 at 102,537,599 bp
  • G to C, chromosome 9 at 122,166,320 bp
  • C to T, chromosome 10 at 39,846,729 bp
  • T to A, chromosome 10 at 62,667,841 bp
  • T to G, chromosome 10 at 95,392,819 bp
  • T to A, chromosome 10 at 107,777,592 bp
  • C to T, chromosome 10 at 127,498,416 bp
  • A to G, chromosome 11 at 52,099,110 bp
  • T to C, chromosome 11 at 58,552,051 bp
  • T to A, chromosome 11 at 88,047,858 bp
  • T to A, chromosome 11 at 114,804,342 bp
  • T to A, chromosome 11 at 120,641,224 bp
  • A to T, chromosome 12 at 91,824,884 bp
  • T to A, chromosome 14 at 49,303,489 bp
  • T to C, chromosome 14 at 53,443,750 bp
  • A to C, chromosome 14 at 54,507,916 bp
  • T to A, chromosome 14 at 62,404,579 bp
  • T to A, chromosome 14 at 65,008,072 bp
  • C to T, chromosome 15 at 11,027,785 bp
  • A to T, chromosome 16 at 4,056,422 bp
  • A to G, chromosome 16 at 33,966,974 bp
  • T to A, chromosome 16 at 46,069,653 bp
  • T to C, chromosome 17 at 34,959,007 bp
  • C to A, chromosome 17 at 85,051,975 bp
  • A to G, chromosome 18 at 24,003,721 bp
  • T to G, chromosome 19 at 6,071,033 bp
  • A to T, chromosome 19 at 41,376,106 bp
  • A to G, chromosome 19 at 47,113,537 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5261 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042830-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.