Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5278Btlr/Mmmh
Stock Number:
042865-MU
Citation ID:
RRID:MMRRC_042865-MU
Other Names:
R5278 (G1), C57BL/6J-MtgxR5278Btlr
Major Collection:

Strain Information

Polr3e
Name: polymerase (RNA) III (DNA directed) polypeptide E
Synonyms: RPC5, Sin
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26939
Homologene: 14052
Pank4
Name: pantothenate kinase 4
Synonyms: D030031I12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269614
Homologene: 41235
Bcl2l2
Name: BCL2-like 2
Synonyms: bclw, Gtrgal2, Gtrosa41, Bcl-w
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12050
HGNC: HGNC:995
Homologene: 2989
Jade1
Name: jade family PHD finger 1
Synonyms: D530048A03Rik, Phf17
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 269424
Homologene: 18162
Prkdc
Name: protein kinase, DNA activated, catalytic polypeptide
Synonyms: DNA-PKcs, slip, DNAPDcs, XRCC7, DNA-PK, DOXNPH, dxnph
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19090
HGNC: HGNC:9413
Homologene: 5037
Igf1r
Name: insulin-like growth factor I receptor
Synonyms: CD221, IGF-1R, line 186, hyft, A330103N21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16001
HGNC: HGNC:5465
Homologene: 30997
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 84,762,147 bp
  • G to A, chromosome 1 at 87,125,166 bp
  • A to T, chromosome 1 at 158,782,403 bp
  • A to T, chromosome 2 at 70,973,297 bp
  • A to G, chromosome 3 at 28,650,060 bp
  • G to T, chromosome 3 at 41,589,009 bp
  • T to C, chromosome 3 at 129,681,251 bp
  • T to G, chromosome 4 at 116,805,936 bp
  • T to A, chromosome 4 at 141,000,818 bp
  • T to C, chromosome 4 at 154,972,165 bp
  • T to A, chromosome 5 at 24,588,090 bp
  • C to T, chromosome 5 at 35,588,156 bp
  • A to G, chromosome 5 at 95,958,727 bp
  • A to G, chromosome 5 at 123,781,014 bp
  • A to T, chromosome 5 at 127,616,969 bp
  • A to G, chromosome 5 at 130,018,831 bp
  • CCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATCC to CCATCAGGATGCACATCAGGATCC, chromosome 6 at 4,756,442 bp
  • T to C, chromosome 6 at 43,167,721 bp
  • C to T, chromosome 7 at 16,278,381 bp
  • T to C, chromosome 7 at 16,793,740 bp
  • T to A, chromosome 7 at 25,805,884 bp
  • C to T, chromosome 7 at 44,896,277 bp
  • T to C, chromosome 7 at 44,902,779 bp
  • G to T, chromosome 7 at 66,679,185 bp
  • C to T, chromosome 7 at 68,193,418 bp
  • G to A, chromosome 7 at 85,411,783 bp
  • T to C, chromosome 7 at 87,371,926 bp
  • A to G, chromosome 7 at 100,552,583 bp
  • T to A, chromosome 7 at 120,922,961 bp
  • G to A, chromosome 7 at 144,068,875 bp
  • A to T, chromosome 8 at 93,525,638 bp
  • CGG to CG, chromosome 9 at 37,411,490 bp
  • A to C, chromosome 9 at 108,082,215 bp
  • G to A, chromosome 9 at 108,091,258 bp
  • A to T, chromosome 9 at 109,555,684 bp
  • G to A, chromosome 9 at 119,432,489 bp
  • T to C, chromosome 10 at 4,354,792 bp
  • A to G, chromosome 11 at 32,381,447 bp
  • A to G, chromosome 11 at 67,334,564 bp
  • A to G, chromosome 11 at 106,567,813 bp
  • A to G, chromosome 13 at 55,676,038 bp
  • C to T, chromosome 14 at 30,352,924 bp
  • T to A, chromosome 14 at 54,884,794 bp
  • T to A, chromosome 15 at 23,474,158 bp
  • T to C, chromosome 16 at 15,714,974 bp
  • A to T, chromosome 16 at 19,515,378 bp
  • A to G, chromosome 16 at 35,697,988 bp
  • G to T, chromosome 16 at 37,186,654 bp
  • A to G, chromosome 16 at 52,274,275 bp
  • G to A, chromosome 16 at 56,221,517 bp
  • T to A, chromosome 17 at 46,510,873 bp
  • A to T, chromosome 18 at 34,762,618 bp
  • G to A, chromosome 19 at 46,134,101 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5278 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The submitter or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042865-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.