Strain Name:
C57BL/6J-MtgxR5278Btlr/Mmmh
Stock Number:
042865-MU
Citation ID:
RRID:MMRRC_042865-MU
Other Names:
R5278 (G1), C57BL/6J-MtgxR5278Btlr
Major Collection:

Strain Information

Polr3e
Name: polymerase (RNA) III (DNA directed) polypeptide E
Synonyms: Sin, RPC5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26939
Homologene: 14052
Pank4
Name: pantothenate kinase 4
Synonyms: D030031I12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269614
Homologene: 41235
Bcl2l2
Name: BCL2-like 2
Synonyms: bclw, Gtrosa41, Gtrgal2, Bcl-w
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12050
Homologene: 2989
Egf
Name: epidermal growth factor
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 13645
HGNC: HGNC:3229
Homologene: 1483
Jade1
Name: jade family PHD finger 1
Synonyms: Phf17, D530048A03Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 269424
Homologene: 18162
Prkdc
Name: protein kinase, DNA activated, catalytic polypeptide
Synonyms: slip, DNAPDcs, DNA-PKcs, DNA-PK, DOXNPH, XRCC7, dxnph
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19090
HGNC: HGNC:9413
Homologene: 5037
Igf1r
Name: insulin-like growth factor I receptor
Synonyms: IGF-1R, A330103N21Rik, hyft, CD221, line 186
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16001
HGNC: HGNC:5465
Homologene: 30997
Fuz
Name: fuzzy planar cell polarity protein
Synonyms: b2b1273Clo, 2600013E07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70300
Homologene: 11840
Kntc1
Name: kinetochore associated 1
Synonyms: jgl
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 208628
Homologene: 32227
Ccdc9
Name: coiled-coil domain containing 9
Synonyms: 2600011L02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243846
Homologene: 9209
Akap12
Name: A kinase anchor protein 12
Synonyms: Tsga12, Srcs5, SSeCKS
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 83397
VEGA: 10
HGNC: HGNC:370
Homologene: 3740
Tex2
Name: testis expressed gene 2
Synonyms: Taz4, 4930568E07Rik, Def-5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21763
Homologene: 32414
Trip12
Name: thyroid hormone receptor interactor 12
Synonyms: Gtl6, 1110036I07Rik, 6720416K24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14897
Homologene: 44226
Ddx46
Name: DEAD box helicase 46
Synonyms: 8430438J23Rik, 2200005K02Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 46
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 212880
VEGA: 13
Homologene: 5430
Slc49a4
Name: solute carrier family 49 member 4
Synonyms: Dirc2, RCC4
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224132
Homologene: 13137
Chpf2
Name: chondroitin polymerizing factor 2
Synonyms: 2010209O12Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100910
Homologene: 14763
Ap2a1
Name: adaptor-related protein complex 2, alpha 1 subunit
Synonyms: Adtaa
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11771
HGNC: HGNC:561
Homologene: 68997
Mrpl48
Name: mitochondrial ribosomal protein L48
Synonyms: D4Ertd786e, CGI-118, 1810030E20Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 52443
Homologene: 32294
Slc15a4
Name: solute carrier family 15, member 4
Synonyms: PHT1, PTR4, C130069N12Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100561
Homologene: 26432
Mettl8
Name: methyltransferase 8, methylcytidine
Synonyms: TIP
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228019
Homologene: 11706
Robo4
Name: roundabout guidance receptor 4
Synonyms: 1200012D01Rik, Magic roundabout
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74144
Homologene: 10397
Peg10
Name: paternally expressed 10
Synonyms: HB-1, Edr, MyEF-3 like, MEF3L, Mart2, Rtl2, MyEF-3, Mar2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Cxcl13
Name: C-X-C motif chemokine ligand 13
Synonyms: BLC, Scyb13, 4631412M08Rik, ANGIE2, BCA-1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 55985
Homologene: 48431
Apeh
Name: acylpeptide hydrolase
Synonyms: N-acylaminoacyl peptide hydrolase
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235606
HGNC: HGNC:586
Homologene: 1240
Tnik
Name: TRAF2 and NCK interacting kinase
Synonyms: 4831440I19Rik, C530008O15Rik, 1500031A17Rik, C630040K21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 665113
Homologene: 77943
Myh13
Name: myosin, heavy polypeptide 13, skeletal muscle
Synonyms: extraocular myosin, MyHC-eo, EO Myosin
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 544791
HGNC: HGNC:7571
Homologene: 55780
Slc1a5
Name: solute carrier family 1 (neutral amino acid transporter), member 5
Synonyms: ASCT2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20514
Homologene: 21155
Cul9
Name: cullin 9
Synonyms: Parc, 1810035I07Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 78309
Homologene: 56696
Cacna1d
Name: calcium channel, voltage-dependent, L type, alpha 1D subunit
Synonyms: Cchl1a2, Cav1.3alpha1, 8430418G19Rik, Cchl1a, D-LTCC, Cacnl1a2, C79217
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12289
VEGA: 14
HGNC: HGNC:1391
Homologene: 578
Elovl3
Name: ELOVL fatty acid elongase 3
Synonyms: elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 3, CIN-2, Cig30
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12686
Homologene: 69006
Impg2
Name: interphotoreceptor matrix proteoglycan 2
Synonyms: PG10.2, IPM200, Spacrcan
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224224
Homologene: 9439
Stxbp5l
Name: syntaxin binding protein 5-like
Synonyms: tomosyn-2, A830015P08Rik, insulin level locus 1, LLGL4, t2md1, T2dm1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207227
Homologene: 18173
Shank2
Name: SH3 and multiple ankyrin repeat domains 2
Synonyms: ProSAP1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 210274
Homologene: 105965
Sh3pxd2b
Name: SH3 and PX domains 2B
Synonyms: Fad49, Tks4, G431001E03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268396
Homologene: 27952
Pappa2
Name: pappalysin 2
Synonyms: pregnancy-associated plasma protein-E, pregnancy-associated plasma preproprotein-A2, placenta-specific 3, PLAC3, PAPP-A2, Pappe
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23850
Homologene: 10661
Ces5a
Name: carboxylesterase 5A
Synonyms: cauxin, LOC244598, 1700122C07Rik, Ces7, 1700081L16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67935
Homologene: 74305
Cyp2s1
Name: cytochrome P450, family 2, subfamily s, polypeptide 1
Synonyms: 1200011C15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74134
Homologene: 75274
Alcam
Name: activated leukocyte cell adhesion molecule
Synonyms: SC1, DM-GRASP, MuSC, BEN, CD166
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 11658
HGNC: HGNC:400
Homologene: 1229
Cdh18
Name: cadherin 18
Synonyms: B230220E17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 320865
HGNC: HGNC:1757
Homologene: 55858
Mst1
Name: macrophage stimulating 1 (hepatocyte growth factor-like)
Synonyms: D3F15S2h, D9H3F15S2, Hgfl, DNF15S2h
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 15235
Homologene: 7360
Fbxw15
Name: F-box and WD-40 domain protein 15
Synonyms: Fbxo12J
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382105
Homologene: 110776
Nox4
Name: NADPH oxidase 4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 50490
HGNC: HGNC:7891
Homologene: 41065
Or2l5
Name: olfactory receptor family 2 subfamily L member 5
Synonyms: MOR272-1, GA_x54KRFPKG5P-15963726-15962788, Olfr167
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258937
Homologene: 78689
Acvr2b
Name: activin receptor IIB
Synonyms: ActRIIB
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11481
VEGA: 9
HGNC: HGNC:174
Homologene: 863
Akp3
Name: alkaline phosphatase 3, intestine, not Mn requiring
Synonyms: Akp-3, IAP
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11648
Homologene: 134333
Asb7
Name: ankyrin repeat and SOCS box-containing 7
Synonyms: D030055C23Rik, Asb-7
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 117589
Homologene: 34130
Toe1
Name: target of EGR1, member 1 (nuclear)
Synonyms: 4930584N22Rik, 4933424D16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68276
Homologene: 11823
Vmn2r69
Name: vomeronasal 2, receptor 69
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330581
Homologene: 115466
Or2a52
Name: olfactory receptor family 2 subfamily A member 52
Synonyms: Olfr437, MOR261-11, GA_x6K02T2P3E9-4391088-4390156
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258293
HGNC: HGNC:8230
Homologene: 122778
Atp13a2
Name: ATPase type 13A2
Synonyms: 1110012E06Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74772
Homologene: 56940
Fam53c
Name: family with sequence similarity 53, member C
Synonyms: 2810012G03Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 66306
VEGA: 18
HGNC: HGNC:1336
Homologene: 9586
Asl
Name: argininosuccinate lyase
Synonyms: 2510006M18Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 109900
HGNC: HGNC:746
Homologene: 32
4931431C16Rik
Name: RIKEN cDNA 4931431C16 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 74364
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 84,762,147 bp
  • G to A, chromosome 1 at 87,125,166 bp
  • A to T, chromosome 1 at 158,782,403 bp
  • A to T, chromosome 2 at 70,973,297 bp
  • A to G, chromosome 3 at 28,650,060 bp
  • G to T, chromosome 3 at 41,589,009 bp
  • T to C, chromosome 3 at 129,681,251 bp
  • T to G, chromosome 4 at 116,805,936 bp
  • T to A, chromosome 4 at 141,000,818 bp
  • T to C, chromosome 4 at 154,972,165 bp
  • T to A, chromosome 5 at 24,588,090 bp
  • C to T, chromosome 5 at 35,588,156 bp
  • A to G, chromosome 5 at 95,958,727 bp
  • A to G, chromosome 5 at 123,781,014 bp
  • A to T, chromosome 5 at 127,616,969 bp
  • A to G, chromosome 5 at 130,018,831 bp
  • CCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATCC to CCATCAGGATGCACATCAGGATCC, chromosome 6 at 4,756,442 bp
  • T to C, chromosome 6 at 43,167,721 bp
  • C to T, chromosome 7 at 16,278,381 bp
  • T to C, chromosome 7 at 16,793,740 bp
  • T to A, chromosome 7 at 25,805,884 bp
  • C to T, chromosome 7 at 44,896,277 bp
  • T to C, chromosome 7 at 44,902,779 bp
  • G to T, chromosome 7 at 66,679,185 bp
  • C to T, chromosome 7 at 68,193,418 bp
  • G to A, chromosome 7 at 85,411,783 bp
  • T to C, chromosome 7 at 87,371,926 bp
  • A to G, chromosome 7 at 100,552,583 bp
  • T to A, chromosome 7 at 120,922,961 bp
  • G to A, chromosome 7 at 144,068,875 bp
  • A to T, chromosome 8 at 93,525,638 bp
  • CGG to CG, chromosome 9 at 37,411,490 bp
  • A to C, chromosome 9 at 108,082,215 bp
  • G to A, chromosome 9 at 108,091,258 bp
  • A to T, chromosome 9 at 109,555,684 bp
  • G to A, chromosome 9 at 119,432,489 bp
  • T to C, chromosome 10 at 4,354,792 bp
  • A to G, chromosome 11 at 32,381,447 bp
  • A to G, chromosome 11 at 67,334,564 bp
  • A to G, chromosome 11 at 106,567,813 bp
  • A to G, chromosome 13 at 55,676,038 bp
  • C to T, chromosome 14 at 30,352,924 bp
  • T to A, chromosome 14 at 54,884,794 bp
  • T to A, chromosome 15 at 23,474,158 bp
  • T to C, chromosome 16 at 15,714,974 bp
  • A to T, chromosome 16 at 19,515,378 bp
  • A to G, chromosome 16 at 35,697,988 bp
  • G to T, chromosome 16 at 37,186,654 bp
  • A to G, chromosome 16 at 52,274,275 bp
  • G to A, chromosome 16 at 56,221,517 bp
  • T to A, chromosome 17 at 46,510,873 bp
  • A to T, chromosome 18 at 34,762,618 bp
  • G to A, chromosome 19 at 46,134,101 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5278 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042865-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.