Strain Name:
C57BL/6J-MtgxR5628Btlr/Mmmh
Stock Number:
043167-MU
Citation ID:
RRID:MMRRC_043167-MU
Other Names:
R5628 (G1), C57BL/6J-MtgxR5628Btlr
Major Collection:

Strain Information

Slc26a5
Name: solute carrier family 26, member 5
Synonyms: prestin, Pres
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 80979
HGNC: HGNC:9359
Homologene: 69472
Gpatch4
Name: G patch domain containing 4
Synonyms: Gpatc4, 2610029K21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66614
Homologene: 9203
Atp6v1h
Name: ATPase, H+ transporting, lysosomal V1 subunit H
Synonyms: 0710001F19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108664
Homologene: 7139
Sephs1
Name: selenophosphate synthetase 1
Synonyms: SPS1, 1110046B24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 109079
Homologene: 56558
Map4
Name: microtubule-associated protein 4
Synonyms: MAP 4, Mtap4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17758
HGNC: HGNC:6862
Homologene: 1780
Fbxw8
Name: F-box and WD-40 domain protein 8
Synonyms: 4930438M06Rik, FBXO29, Fbx29, FBW8, FBW6
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231672
Homologene: 17731
Sf3b1
Name: splicing factor 3b, subunit 1
Synonyms: Prp10, 2810001M05Rik, SAP155, Targ4, SF3b155
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 81898
Homologene: 6696
Atr
Name: ataxia telangiectasia and Rad3 related
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245000
HGNC: HGNC:882
Homologene: 96916
Ap3b1
Name: adaptor-related protein complex 3, beta 1 subunit
Synonyms: recombination induced mutation 2, AP-3, rim2, beta3A, Hps2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 11774
VEGA: 13
HGNC: HGNC:566
Homologene: 68125
Cdc40
Name: cell division cycle 40
Synonyms: PRP17, EHB3, 1200003H23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71713
VEGA: 10
Homologene: 5716
Smg1
Name: SMG1 nonsense mediated mRNA decay associated PI3K related kinase
Synonyms: C130002K18Rik, 2610207I05Rik, 5430435M13Rik, SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233789
Homologene: 56697
Zfyve1
Name: zinc finger, FYVE domain containing 1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217695
VEGA: 12
Homologene: 10945
Prdm15
Name: PR domain containing 15
Synonyms: E130018M06Rik, Zfp298
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 114604
Homologene: 56941
Rnf17
Name: ring finger protein 17
Synonyms: MMIP-2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 30054
VEGA: 14
Homologene: 23727
Stard5
Name: StAR related lipid transfer domain containing 5
Synonyms: D7Ertd152e, 18B7-T7(GS), 2310058G22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 170460
Homologene: 11346
Polr2b
Name: polymerase (RNA) II (DNA directed) polypeptide B
Synonyms: RPB2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231329
HGNC: HGNC:9188
Homologene: 722
Casz1
Name: castor zinc finger 1
Synonyms: Cst, D4Ertd432e, castor, 2410019P08Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69743
Homologene: 9824
Adgrl4
Name: adhesion G protein-coupled receptor L4
Synonyms: EGF-TM7 receptor, 1110033N21Rik, Eltd1, Etl
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 170757
Homologene: 11170
Kirrel2
Name: kirre like nephrin family adhesion molecule 2
Synonyms: C330019F22Rik, NEPH3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243911
Homologene: 35249
Dync1li2
Name: dynein, cytoplasmic 1 light intermediate chain 2
Synonyms: LIC2, Dncli2, Dlic2, Dnclic2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234663
HGNC: HGNC:2966
Homologene: 4474
Shq1
Name: SHQ1 homolog (S. cerevisiae)
Synonyms: 2810403P18Rik, Grim-1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 72171
Homologene: 31683
Zfp236
Name: zinc finger protein 236
Synonyms: LOC240456
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 329002
Homologene: 7198
Fnip1
Name: folliculin interacting protein 1
Synonyms: A730024A03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216742
Homologene: 28173
Szt2
Name: SZT2 subunit of KICSTOR complex
Synonyms: seaizure threshold 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230676
Homologene: 49413
Trpm2
Name: transient receptor potential cation channel, subfamily M, member 2
Synonyms: Trrp7, TRPC7, 9830168K16Rik, LTRPC2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 28240
Homologene: 20709
Idh2
Name: isocitrate dehydrogenase 2 (NADP+), mitochondrial
Synonyms: IDPm, Idh-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269951
HGNC: HGNC:5383
Homologene: 37590
Clcn1
Name: chloride channel, voltage-sensitive 1
Synonyms: Clc-1, Clc1, SMCC1, NMF355, nmf355
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12723
HGNC: HGNC:2019
Homologene: 63
Cmya5
Name: cardiomyopathy associated 5
Synonyms: Myospryn, 2310076E21Rik, 2310076E16Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76469
VEGA: 13
Homologene: 137367
Rusc2
Name: RUN and SH3 domain containing 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100213
Homologene: 18967
Dnah2
Name: dynein, axonemal, heavy chain 2
Synonyms: Dnahc2, Dnhd3, D330014H01Rik, 2900022L05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327954
HGNC: HGNC:2948
Homologene: 72110
Fat3
Name: FAT atypical cadherin 3
Synonyms: 9430076A06Rik, D430038H04Rik, LOC382129, LOC234973
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270120
VEGA: 9
Homologene: 82252
Ephb3
Name: Eph receptor B3
Synonyms: Sek4, Etk2, HEK2, Tyro6, Cek10, MDK5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13845
HGNC: HGNC:3394
Homologene: 20938
Or5m10b
Name: olfactory receptor family 5 subfamily M member 10B
Synonyms: Olfr1022, MOR196-1, GA_x6K02T2Q125-47347069-47348016
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258582
Homologene: 128086
Myt1l
Name: myelin transcription factor 1-like
Synonyms: Pmng1, 2900046C06Rik, 2900093J19Rik, Nztf1, C630034G21Rik, Png-1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 17933
VEGA: 12
HGNC: HGNC:7623
Homologene: 7435
Adam25
Name: ADAM metallopeptidase domain 25
Synonyms: testase 2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23793
HGNC: HGNC:199
Homologene: 128364
Rev3l
Name: REV3 like, DNA directed polymerase zeta catalytic subunit
Synonyms: Sez4, Rev
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19714
HGNC: HGNC:9968
Homologene: 48147
B3galnt2
Name: UDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 2
Synonyms: A930105D20Rik, D230016N13Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 97884
VEGA: 13
Homologene: 17595
Fam186a
Name: family with sequence similarity 186, member A
Synonyms: LOC380973, 1700030F18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72277
Tmem217
Name: transmembrane protein 217
Synonyms: 4933413N12Rik, EG622644
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71138
VEGA: 17
Homologene: 51671
Vmn1r82
Name: vomeronasal 1 receptor 82
Synonyms: V1rg12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 171268
Mindy4
Name: MINDY lysine 48 deubiquitinase 4
Synonyms: Fam188b, LOC384387, C330043M08Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330323
Homologene: 49991
Prr36
Name: proline rich 36
Synonyms: BC068157
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 73072
Homologene: 136398
Kctd15
Name: potassium channel tetramerisation domain containing 15
Synonyms: MGC25497
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233107
Homologene: 11450
Gramd2a
Name: GRAM domain containing 2A
Synonyms: Gramd2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 546134
Homologene: 52791
A730045E13Rik
Name: RIKEN cDNA A730045E13 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Gm2366
Name: predicted gene 2366
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 5,135,889 bp
  • C to T, chromosome 1 at 54,998,175 bp
  • T to C, chromosome 2 at 4,889,207 bp
  • T to A, chromosome 2 at 85,868,805 bp
  • T to A, chromosome 3 at 88,054,478 bp
  • C to T, chromosome 3 at 151,492,398 bp
  • C to T, chromosome 4 at 43,425,348 bp
  • A to G, chromosome 4 at 118,373,217 bp
  • T to C, chromosome 4 at 148,946,096 bp
  • T to A, chromosome 5 at 21,816,976 bp
  • G to A, chromosome 5 at 77,313,216 bp
  • A to G, chromosome 5 at 118,092,557 bp
  • T to C, chromosome 6 at 42,298,889 bp
  • C to T, chromosome 6 at 55,260,594 bp
  • A to G, chromosome 6 at 100,631,003 bp
  • T to G, chromosome 7 at 12,305,278 bp
  • C to T, chromosome 7 at 30,453,464 bp
  • T to C, chromosome 7 at 34,640,295 bp
  • GGCCAGC to G, chromosome 7 at 80,098,349 bp
  • T to C, chromosome 7 at 83,633,147 bp
  • C to T, chromosome 7 at 118,154,701 bp
  • TGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGC to TGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGC, chromosome 8 at 4,216,273 bp
  • G to A, chromosome 8 at 24,185,131 bp
  • A to G, chromosome 8 at 40,755,710 bp
  • G to A, chromosome 8 at 45,017,915 bp
  • T to C, chromosome 8 at 104,420,592 bp
  • T to C, chromosome 9 at 15,966,096 bp
  • T to C, chromosome 9 at 59,707,723 bp
  • T to A, chromosome 9 at 95,874,226 bp
  • A to G, chromosome 9 at 110,081,847 bp
  • C to T, chromosome 9 at 110,514,553 bp
  • T to A, chromosome 10 at 39,822,967 bp
  • T to G, chromosome 10 at 40,851,053 bp
  • C to T, chromosome 10 at 77,912,636 bp
  • A to T, chromosome 11 at 54,503,633 bp
  • C to T, chromosome 11 at 69,458,920 bp
  • T to A, chromosome 12 at 29,811,621 bp
  • A to T, chromosome 12 at 83,574,889 bp
  • A to T, chromosome 13 at 13,995,152 bp
  • A to G, chromosome 13 at 93,089,710 bp
  • A to G, chromosome 13 at 94,477,048 bp
  • A to G, chromosome 14 at 56,486,952 bp
  • A to C, chromosome 15 at 99,941,747 bp
  • T to C, chromosome 16 at 21,218,119 bp
  • T to A, chromosome 16 at 97,799,623 bp
  • A to T, chromosome 17 at 29,526,456 bp
  • A to G, chromosome 18 at 31,974,187 bp
  • T to C, chromosome 18 at 82,657,122 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5628 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043167-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.