Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5701Btlr/Mmmh
Stock Number:
043181-MU
Citation ID:
RRID:MMRRC_043181-MU
Other Names:
R5701 (G1), C57BL/6J-MtgxR5701Btlr
Major Collection:

Strain Information

Myh9
Name: myosin, heavy polypeptide 9, non-muscle
Synonyms: D0Jmb2, E030044M24Rik, NMHC II-A, Myhn-1, Myhn1, myosin IIA, Fltn
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17886
HGNC: HGNC:7579
Homologene: 129835
Kmt2c
Name: lysine (K)-specific methyltransferase 2C
Synonyms: E330008K23Rik, HALR, Mll3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231051
Homologene: 46480
Notch2
Name: notch 2
Synonyms: Motch B, N2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18129
HGNC: HGNC:7882
Homologene: 7865
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Rnf145
Name: ring finger protein 145
Synonyms: 3732413I11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74315
Homologene: 14427
Rbm25
Name: RNA binding motif protein 25
Synonyms: 2610015J01Rik, A130095G20Rik, 2600011C06Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 67039
Rapgef6
Name: Rap guanine nucleotide exchange factor (GEF) 6
Synonyms: PDZ-GEF2, RA-GEF-2, Pdzgef2, C030018K18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192786
Homologene: 22968
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 87,197,658 bp
  • G to A, chromosome 1 at 173,274,847 bp
  • C to T, chromosome 2 at 21,746,709 bp
  • A to G, chromosome 2 at 85,951,824 bp
  • A to G, chromosome 2 at 153,399,489 bp
  • T to A, chromosome 3 at 36,921,360 bp
  • A to G, chromosome 3 at 98,072,870 bp
  • C to G, chromosome 3 at 123,080,230 bp
  • A to T, chromosome 4 at 123,503,225 bp
  • A to G, chromosome 5 at 25,314,017 bp
  • T to A, chromosome 5 at 105,118,399 bp
  • T to C, chromosome 5 at 109,219,950 bp
  • T to C, chromosome 5 at 123,613,303 bp
  • C to T, chromosome 5 at 143,254,377 bp
  • T to C, chromosome 6 at 88,893,091 bp
  • T to G, chromosome 6 at 115,797,932 bp
  • A to G, chromosome 7 at 12,670,565 bp
  • T to C, chromosome 8 at 21,583,847 bp
  • T to A, chromosome 9 at 21,281,129 bp
  • G to A, chromosome 9 at 39,592,822 bp
  • C to T, chromosome 9 at 80,258,527 bp
  • A to T, chromosome 9 at 92,205,511 bp
  • A to G, chromosome 9 at 99,496,149 bp
  • A to T, chromosome 9 at 107,522,163 bp
  • T to C, chromosome 10 at 80,381,545 bp
  • T to A, chromosome 11 at 32,193,263 bp
  • T to A, chromosome 11 at 42,487,374 bp
  • G to A, chromosome 11 at 44,531,293 bp
  • T to A, chromosome 11 at 51,653,729 bp
  • T to C, chromosome 11 at 54,676,394 bp
  • A to G, chromosome 11 at 120,785,182 bp
  • T to A, chromosome 12 at 83,668,457 bp
  • A to T, chromosome 13 at 34,990,267 bp
  • C to T, chromosome 14 at 31,274,044 bp
  • A to G, chromosome 14 at 96,201,380 bp
  • T to C, chromosome 15 at 47,650,221 bp
  • A to T, chromosome 15 at 48,540,333 bp
  • T to C, chromosome 15 at 77,791,764 bp
  • T to C, chromosome 15 at 81,601,495 bp
  • T to C, chromosome 15 at 91,910,370 bp
  • T to C, chromosome 15 at 102,981,881 bp
  • T to C, chromosome 16 at 45,116,378 bp
  • TTGCTGCTGCTGCTGCTGCTGGTGCTGCTGCTGCTG to TTGCTGCTGCTGCTGCTGGTGCTGCTGCTGCTG, chromosome 17 at 50,799,955 bp
  • T to C, chromosome 17 at 74,697,425 bp
  • T to A, chromosome 18 at 80,272,478 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5701 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The submitter or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043181-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.