Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5810Btlr/Mmmh
Stock Number:
043395-MU
Citation ID:
RRID:MMRRC_043395-MU
Other Names:
R5810 (G1)
Major Collection:

Strain Information

Epb41l1
Name: erythrocyte membrane protein band 4.1 like 1
Synonyms: 4.1N, Epb4.1l1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13821
HGNC: HGNC:3378
Homologene: 8126
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Tfpi
Name: tissue factor pathway inhibitor
Synonyms: A630013F22Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21788
Homologene: 4579
Stx1a
Name: syntaxin 1A (brain)
Synonyms: HPC-1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20907
Homologene: 37941
Fryl
Name: FRY like transcription coactivator
Synonyms: 2310004H21Rik, 2510002A14Rik, 9030227G01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72313
Homologene: 103956
Triobp
Name: TRIO and F-actin binding protein
Synonyms: Mus EST 478828, Tara, EST478828
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110253
Homologene: 5104
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: apollon, Bruce, A430032G04Rik, D630005A10Rik, A430040A19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 20,200,673 bp
  • G to A, chromosome 1 at 34,183,040 bp
  • A to G, chromosome 1 at 36,525,199 bp
  • G to A, chromosome 1 at 85,665,285 bp
  • A to T, chromosome 1 at 97,075,873 bp
  • A to G, chromosome 1 at 125,416,379 bp
  • A to G, chromosome 2 at 11,733,252 bp
  • C to A, chromosome 2 at 30,142,368 bp
  • AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA to AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA, chromosome 2 at 84,434,424 bp
  • T to C, chromosome 2 at 150,950,168 bp
  • G to A, chromosome 2 at 154,163,718 bp
  • A to G, chromosome 2 at 155,751,407 bp
  • A to T, chromosome 2 at 156,499,655 bp
  • A to C, chromosome 3 at 14,641,768 bp
  • G to A, chromosome 3 at 59,319,071 bp
  • A to T, chromosome 3 at 64,117,394 bp
  • T to C, chromosome 4 at 43,518,968 bp
  • A to G, chromosome 4 at 53,079,631 bp
  • A to T, chromosome 4 at 92,191,583 bp
  • A to G, chromosome 4 at 109,086,374 bp
  • A to T, chromosome 5 at 73,090,755 bp
  • A to G, chromosome 5 at 112,834,450 bp
  • T to C, chromosome 5 at 113,946,566 bp
  • G to T, chromosome 5 at 135,049,078 bp
  • C to T, chromosome 6 at 48,483,898 bp
  • C to A, chromosome 6 at 52,213,216 bp
  • T to C, chromosome 6 at 52,216,024 bp
  • C to T, chromosome 6 at 113,469,596 bp
  • A to T, chromosome 7 at 13,260,735 bp
  • G to T, chromosome 7 at 19,152,522 bp
  • G to A, chromosome 7 at 35,295,371 bp
  • A to T, chromosome 7 at 43,636,958 bp
  • T to A, chromosome 7 at 120,435,932 bp
  • T to A, chromosome 7 at 132,760,164 bp
  • T to A, chromosome 7 at 140,145,985 bp
  • C to T, chromosome 8 at 62,012,388 bp
  • G to A, chromosome 8 at 123,094,569 bp
  • A to G, chromosome 9 at 65,128,695 bp
  • C to T, chromosome 9 at 107,929,221 bp
  • C to T, chromosome 10 at 40,595,318 bp
  • G to T, chromosome 10 at 118,860,340 bp
  • T to C, chromosome 11 at 5,803,417 bp
  • G to T, chromosome 11 at 73,486,095 bp
  • G to A, chromosome 12 at 54,927,715 bp
  • T to C, chromosome 13 at 15,644,309 bp
  • T to A, chromosome 13 at 22,244,427 bp
  • A to C, chromosome 13 at 23,357,409 bp
  • A to G, chromosome 14 at 24,146,254 bp
  • G to T, chromosome 14 at 45,602,707 bp
  • A to G, chromosome 14 at 74,745,611 bp
  • T to C, chromosome 15 at 36,775,266 bp
  • T to C, chromosome 15 at 78,968,267 bp
  • T to A, chromosome 15 at 89,374,331 bp
  • A to T, chromosome 16 at 21,968,110 bp
  • T to C, chromosome 16 at 88,874,236 bp
  • T to C, chromosome 17 at 19,677,542 bp
  • T to A, chromosome 17 at 32,906,098 bp
  • A to C, chromosome 17 at 74,670,374 bp
  • C to T, chromosome 18 at 37,959,873 bp
  • T to C, chromosome 19 at 7,606,720 bp
  • A to G, chromosome 19 at 8,623,858 bp
  • T to C, chromosome 19 at 16,666,324 bp
  • A to G, chromosome 19 at 45,748,205 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5810 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043395-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.