Strain Name:
C57BL/6J-MtgxR5905Btlr
Stock Number:
044102-MU
Citation ID:
RRID:MMRRC_044102-MU
Other Names:
R5905 (G1)
Major Collection:

Gene Information

Chd7
Name: chromodomain helicase DNA binding protein 7
Synonyms: GENA 60, GENA 47, Gena 52, Cyn, A730019I05Rik, WBE1, Whi, Todo, Obt, Mt, Lda, Flo, Edy, Dz, Cycn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 320790
Homologene: 19067
Mc3r
Name: melanocortin 3 receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 17201
HGNC: HGNC:6931
Homologene: 7412
Sox9
Name: SRY (sex determining region Y)-box 9
Synonyms: 2010306G03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 20682
Homologene: 294
Nfia
Name: nuclear factor I/A
Synonyms: 1110047K16Rik, NF1-A, 9430022M17Rik, NF1A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 18027
HGNC: HGNC:7784
Homologene: 4086
F2r
Name: coagulation factor II (thrombin) receptor
Synonyms: thrombin receptor, Par1, Cf2r, ThrR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 14062
VEGA: 13
HGNC: HGNC:3537
Homologene: 1510
Asah2
Name: N-acylsphingosine amidohydrolase 2
Synonyms: neutral/alkaline ceramidase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 54447
VEGA: 19
Homologene: 10310
Zfhx3
Name: zinc finger homeobox 3
Synonyms: WBP9, A230102L03Rik, Atbf1, Sci
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 11906
HGNC: HGNC:777
Homologene: 21366
Fbxl20
Name: F-box and leucine-rich repeat protein 20
Synonyms: C86145, Fbl2, 2610511F20Rik, 4632423N09Rik, Scr, Scrapper
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 72194
Homologene: 68784
Fnbp4
Name: formin binding protein 4
Synonyms: FBP30
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 55935
Homologene: 9087
Faf1
Name: Fas-associated factor 1
Synonyms: Fam, Dffrx
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 14084
HGNC: HGNC:3578
Homologene: 5120
Trrap
Name: transformation/transcription domain-associated protein
Synonyms: transactivation/transformation-domain associated protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100683
Homologene: 39246
Arf4
Name: ADP-ribosylation factor 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 11843
HGNC: HGNC:655
Homologene: 55593
Zfp292
Name: zinc finger protein 292
Synonyms: Zn-16, Zn-15, Krox-10, Zfp-15, 9430062L07Rik, 5730450D02Rik, Zfp15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 30046
Homologene: 8493
Snrpb
Name: small nuclear ribonucleoprotein B
Synonyms: SNRNP-B, SM11, SMB, SM-B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20638
Homologene: 134543
Marf1
Name: meiosis regulator and mRNA stability 1
Synonyms: 4921513D23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 223989
VEGA: 16
Homologene: 40967
Cc2d2a
Name: coiled-coil and C2 domain containing 2A
Synonyms: 5730509K17Rik, b2b1035Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231214
Homologene: 18159
Mepce
Name: methylphosphate capping enzyme
Synonyms: D5Wsu46e, Bcdin3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231803
Homologene: 32447
Ap3d1
Name: adaptor-related protein complex 3, delta 1 subunit
Synonyms: mBLVR1, Bolvr
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 11776
VEGA: 10
HGNC: HGNC:568
Homologene: 2926
Dmap1
Name: DNA methyltransferase 1-associated protein 1
Synonyms: 1500016M21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 66233
Homologene: 41311
Fan1
Name: FANCD2/FANCI-associated nuclease 1
Synonyms: 6030441H18Rik, Mtmr15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 330554
Homologene: 45598
Egfr
Name: epidermal growth factor receptor
Synonyms: avian erythroblastic leukemia viral (v-erb-b) oncogene homolog, Erbb, Wa5, 9030024J15Rik, Errb1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 13649
HGNC: HGNC:3236
Homologene: 74545
Syt17
Name: synaptotagmin XVII
Synonyms: Bk
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 110058
Homologene: 9553
Hgfac
Name: hepatocyte growth factor activator
Synonyms: HGFA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 54426
HGNC: HGNC:4894
Homologene: 1170
Adamtsl1
Name: ADAMTS-like 1
Synonyms: punctin-1, 6720426B09Rik, 5930437A14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 77739
Homologene: 64642
Lman1l
Name: lectin, mannose-binding 1 like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235416
HGNC: HGNC:6632
Homologene: 11047
Hk1
Name: hexokinase 1
Synonyms: Hk-1, mHk1-s, Hk1-s
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 15275
HGNC: HGNC:4922
Homologene: 100530
Tcf25
Name: transcription factor 25 (basic helix-loop-helix)
Synonyms: 1810041K11Rik, 1100001J13Rik, Nulp1, D8Ertd325e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 66855
Homologene: 5701
Pja2
Name: praja ring finger ubiquitin ligase 2
Synonyms: Neurodap1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224938
Homologene: 32233
Cachd1
Name: cache domain containing 1
Synonyms: 1190007F10Rik, Vwcd1, B430218L07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 320508
Homologene: 10854
Eps8l2
Name: EPS8-like 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 98845
Homologene: 69358
Strbp
Name: spermatid perinuclear RNA binding protein
Synonyms: Spnr, 6430510M02Rik, C230082I21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20744
Homologene: 7548
Cdh23
Name: cadherin 23 (otocadherin)
Synonyms: 4930542A03Rik, USH1D, mdfw, ahl, bob, nmf112, nmf181, nmf252, sals
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 22295
Homologene: 11142
Nacc2
Name: nucleus accumbens associated 2, BEN and BTB (POZ) domain containing
Synonyms: 0610020I02Rik, C030048H19Rik, Btbd14a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 67991
Homologene: 75239
Dnah5
Name: dynein, axonemal, heavy chain 5
Synonyms: Mdnah5, b2b1154Clo, b2b1134Clo, b2b1537Clo, b2b1565Clo, Dnahc5, b2b3491Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 110082
HGNC: HGNC:2950
Homologene: 1048
Pclo
Name: piccolo (presynaptic cytomatrix protein)
Synonyms: Acz, Pico
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 26875
Homologene: 69111
Pcsk2
Name: proprotein convertase subtilisin/kexin type 2
Synonyms: prohormone convertase 2, Phpp-2, Nec-2, Nec2, PC2, SPC2, 6330411F23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18549
HGNC: HGNC:8744
Homologene: 37640
Zc3hav1
Name: zinc finger CCCH type, antiviral 1
Synonyms: ZAP, 9130009D18Rik, 1200014N16Rik, 2900058M19Rik, 9830115L13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 78781
Homologene: 10585
Dnah11
Name: dynein, axonemal, heavy chain 11
Synonyms: lrd, b2b1203Clo, b2b1279Clo, b2b598Clo, b2b1289Clo, b2b1727Clo, Dnahc11, avc4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 13411
HGNC: HGNC:2942
Homologene: 2801
Cd180
Name: CD180 antigen
Synonyms: RP105, Ly78
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17079
HGNC: HGNC:6726
Homologene: 4077
Nlrp9a
Name: NLR family, pyrin domain containing 9A
Synonyms: D7Ertd565e, Nalp-theta, Nalp9a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233001
Homologene: 116072
Neb
Name: nebulin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 17996
HGNC: HGNC:7720
Homologene: 136285
Hrc
Name: histidine rich calcium binding protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 15464
HGNC: HGNC:5178
Homologene: 137234
Taf5l
Name: TATA-box binding protein associated factor 5 like
Synonyms: 1110005N04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 102162
Homologene: 8676
Inhba
Name: inhibin beta-A
Synonyms: activin beta-A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 16323
VEGA: 13
HGNC: HGNC:6066
Homologene: 1653
Vmn2r3
Name: vomeronasal 2, receptor 3
Synonyms: EG637004
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 637004
Zfp652
Name: zinc finger protein 652
Synonyms: 9530033F24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 268469
Homologene: 54768
Rapgef5
Name: Rap guanine nucleotide exchange factor (GEF) 5
Synonyms: mr-gef, D030051B22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217944
VEGA: 12
Homologene: 56563
Slc4a11
Name: solute carrier family 4, sodium bicarbonate transporter-like, member 11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 269356
Homologene: 12931
Lipm
Name: lipase, family member M
Synonyms: 4632427C23Rik, Lipl3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 78753
VEGA: 19
Homologene: 28267
Wnk2
Name: WNK lysine deficient protein kinase 2
Synonyms: ESTM15, 1810073P09Rik, X83337
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 75607
Homologene: 19155
Gm884
Name: predicted gene 884
Synonyms: LOC380730
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 380730
Homologene: 134511
Otoa
Name: otoancorin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 246190
Homologene: 71803
Lmod3
Name: leiomodin 3 (fetal)
Synonyms: 5430424A14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 320502
HGNC: HGNC:6649
Homologene: 28097
Cntln
Name: centlein, centrosomal protein
Synonyms: B430108F07Rik, D530005L17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 338349
Homologene: 9805
Grk4
Name: G protein-coupled receptor kinase 4
Synonyms: A830025H08Rik, Gprk2l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 14772
HGNC: HGNC:4543
Homologene: 23158
Prss36
Name: protease, serine 36
Synonyms: polyserase-2, C330007D15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 77613
Homologene: 18303
Vmn1r216
Name: vomeronasal 1 receptor 216
Synonyms: V1ri10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 171279
Homologene: 110880
Als2cl
Name: ALS2 C-terminal like
Synonyms: mRn.49018, D930044G19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235633
Homologene: 17152
Map9
Name: microtubule-associated protein 9
Synonyms: 5033421J10Rik, 5330427D05Rik, ASAP, Mtap9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 213582
Homologene: 41591
Olfr763
Name: olfactory receptor 763
Synonyms: GA_x6K02T2PULF-10696986-10697915, MOR269-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 258861
Homologene: 85121
Sult1d1
Name: sulfotransferase family 1D, member 1
Synonyms: tyrosine-ester sulfotransferase, 5033411P13Rik, Sultn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 53315
Homologene: 124464
Polb
Name: polymerase (DNA directed), beta
Synonyms: Pol beta, A430088C08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 18970
HGNC: HGNC:9174
Homologene: 2013
Grip1
Name: glutamate receptor interacting protein 1
Synonyms: 4931400F03Rik, eb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 74053
Homologene: 12938
Olfr689
Name: olfactory receptor 689
Synonyms: GA_x6K02T2PBJ9-7942985-7943947, MOR40-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258745
Homologene: 128074
Fam149b
Name: family with sequence similarity 149, member B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 105428
VEGA: 14
Homologene: 67023
Tas2r131
Name: taste receptor, type 2, member 131
Synonyms: mGR31, Tas2r31, mt2r61, T2R31
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 387356
Homologene: 52298
Lrrc63
Name: leucine rich repeat containing 63
Synonyms: 4921509B22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 70859
Homologene: 52823
Popdc3
Name: popeye domain containing 3
Synonyms: Pop3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 78977
Homologene: 32540
Mical1
Name: microtubule associated monooxygenase, calponin and LIM domain containing 1
Synonyms: Nical
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 171580
Homologene: 11246
Tmem253
Name: transmembrane protein 253
Synonyms: G630016D24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 619301
VEGA: 14
Homologene: 83921
Zfp964
Name: zinc finger protein 964
Synonyms: Gm7187
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 636741
Homologene: 130114
Olfr938
Name: olfactory receptor 938
Synonyms: GA_x6K02T2PVTD-32774646-32773699, MOR171-25
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258430
VEGA: 9
Zfp354c
Name: zinc finger protein 354C
Synonyms: Kid3, AJ18, 5330421P20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 30944
Homologene: 56606
Catsperb
Name: cation channel sperm associated auxiliary subunit beta
Synonyms: 4932415G16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 271036
VEGA: 12
Homologene: 81904
Acat1
Name: acetyl-Coenzyme A acetyltransferase 1
Synonyms: Acat, 6330585C21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 110446
HGNC: HGNC:93
Homologene: 6
Mmp21
Name: matrix metallopeptidase 21
Synonyms: b2b873Clo, b2b2458Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 214766
Homologene: 17519
Tspan17
Name: tetraspanin 17
Synonyms: 2210021G21Rik, Fbxo23, Tm4sf17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 74257
Homologene: 41762
Arhgap8
Name: Rho GTPase activating protein 8
Synonyms: 3110043J09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 73167
Homologene: 23645
Hax1
Name: HCLS1 associated X-1
Synonyms: mHAX-1s, HAX-1, Silg111, Hs1bp1, HS1-associated protein X-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 23897
Homologene: 4463
Pigz
Name: phosphatidylinositol glycan anchor biosynthesis, class Z
Synonyms: F630022B06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 239827
Homologene: 130742
Olfr625-ps1
Name: olfactory receptor 625, pseudogene 1
Synonyms: GA_x6K02T2PBJ9-6416276-6417237, MOR31-15P
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258169
Smpd2
Name: sphingomyelin phosphodiesterase 2, neutral
Synonyms: nSMase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 20598
Homologene: 31129
Olfr12
Name: olfactory receptor 12
Synonyms: GA_x6K02T2R7CC-81134096-81133095, MOR208-5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 257890
Homologene: 114777
Olfr1079
Name: olfactory receptor 1079
Synonyms: GA_x6K02T2Q125-48024195-48023254, MOR189-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258402
Homologene: 74090
1810062G17Rik
Name: RIKEN cDNA 1810062G17 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 72282
Alad
Name: aminolevulinate, delta-, dehydratase
Synonyms: Lv
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 17025
HGNC: HGNC:395
Homologene: 16
Gm9747
Name: predicted gene 9747
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 82,234,298 bp
  • T to A, chromosome 1 at 92,620,142 bp
  • A to G, chromosome 2 at 26,061,578 bp
  • G to A, chromosome 2 at 37,625,255 bp
  • G to A, chromosome 2 at 52,193,231 bp
  • T to A, chromosome 2 at 86,538,769 bp
  • C to A, chromosome 2 at 90,751,134 bp
  • T to A, chromosome 2 at 130,179,276 bp
  • T to A, chromosome 2 at 130,685,052 bp
  • T to A, chromosome 2 at 143,749,140 bp
  • A to T, chromosome 2 at 172,249,209 bp
  • T to A, chromosome 3 at 36,479,569 bp
  • T to A, chromosome 3 at 64,275,277 bp
  • T to A, chromosome 3 at 82,380,248 bp
  • GTCATCATCATCATCATC to GTCATCATCATCATCATCATC, chromosome 3 at 89,997,940 bp
  • C to A, chromosome 4 at 8,840,553 bp
  • A to G, chromosome 4 at 34,819,549 bp
  • G to T, chromosome 4 at 62,510,122 bp
  • T to A, chromosome 4 at 84,971,173 bp
  • C to A, chromosome 4 at 86,342,324 bp
  • A to G, chromosome 4 at 98,111,251 bp
  • C to A, chromosome 4 at 100,983,556 bp
  • T to A, chromosome 4 at 109,890,929 bp
  • G to T, chromosome 4 at 117,676,766 bp
  • A to T, chromosome 5 at 14,680,385 bp
  • A to C, chromosome 5 at 34,711,730 bp
  • A to G, chromosome 5 at 35,042,362 bp
  • A to T, chromosome 5 at 43,712,426 bp
  • A to T, chromosome 5 at 87,559,826 bp
  • A to G, chromosome 5 at 137,784,720 bp
  • A to G, chromosome 5 at 144,849,920 bp
  • T to C, chromosome 6 at 38,307,340 bp
  • T to A, chromosome 6 at 97,247,614 bp
  • T to G, chromosome 6 at 132,957,676 bp
  • C to T, chromosome 7 at 26,558,337 bp
  • G to A, chromosome 7 at 45,336,234 bp
  • C to A, chromosome 7 at 64,353,651 bp
  • T to A, chromosome 7 at 103,683,574 bp
  • T to C, chromosome 7 at 105,314,951 bp
  • T to C, chromosome 7 at 118,436,918 bp
  • T to A, chromosome 7 at 121,094,601 bp
  • T to C, chromosome 7 at 127,933,572 bp
  • T to C, chromosome 7 at 133,678,714 bp
  • T to C, chromosome 7 at 141,357,833 bp
  • G to T, chromosome 8 at 22,639,995 bp
  • A to G, chromosome 8 at 69,663,913 bp
  • C to T, chromosome 8 at 108,793,503 bp
  • A to G, chromosome 8 at 123,381,437 bp
  • A to C, chromosome 8 at 124,002,975 bp
  • T to A, chromosome 9 at 39,078,083 bp
  • A to T, chromosome 9 at 53,592,066 bp
  • A to G, chromosome 9 at 57,608,263 bp
  • G to T, chromosome 9 at 110,898,084 bp
  • A to T, chromosome 10 at 41,486,877 bp
  • A to G, chromosome 10 at 41,489,348 bp
  • A to G, chromosome 10 at 45,317,919 bp
  • G to T, chromosome 10 at 60,534,535 bp
  • C to A, chromosome 10 at 62,353,058 bp
  • T to C, chromosome 10 at 80,722,927 bp
  • A to G, chromosome 10 at 119,985,492 bp
  • A to T, chromosome 10 at 129,011,287 bp
  • A to T, chromosome 11 at 16,911,494 bp
  • T to C, chromosome 11 at 50,815,426 bp
  • G to A, chromosome 11 at 95,749,863 bp
  • A to G, chromosome 11 at 98,115,445 bp
  • A to T, chromosome 11 at 103,614,255 bp
  • A to G, chromosome 11 at 112,783,820 bp
  • T to A, chromosome 12 at 101,602,700 bp
  • T to A, chromosome 12 at 117,748,426 bp
  • C to T, chromosome 12 at 117,954,924 bp
  • T to A, chromosome 13 at 16,017,308 bp
  • C to T, chromosome 13 at 23,099,197 bp
  • G to T, chromosome 13 at 49,076,345 bp
  • A to G, chromosome 13 at 54,793,298 bp
  • A to G, chromosome 13 at 95,604,613 bp
  • A to T, chromosome 13 at 102,706,033 bp
  • C to T, chromosome 14 at 20,359,910 bp
  • A to G, chromosome 14 at 26,653,924 bp
  • A to G, chromosome 14 at 52,017,811 bp
  • A to G, chromosome 14 at 75,086,174 bp
  • T to A, chromosome 15 at 28,387,833 bp
  • A to T, chromosome 15 at 84,741,977 bp
  • T to A, chromosome 16 at 14,127,249 bp
  • A to G, chromosome 16 at 31,945,428 bp
  • T to C, chromosome 17 at 64,309,090 bp
  • T to C, chromosome 19 at 32,016,514 bp
  • T to C, chromosome 19 at 34,111,911 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5905 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
044102-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.