Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6028Btlr/Mmmh
Stock Number:
044200-MU
Citation ID:
RRID:MMRRC_044200-MU
Other Names:
R6028 (G1)
Major Collection:

Strain Information

Prkar2b
Name: protein kinase, cAMP dependent regulatory, type II beta
Synonyms: Pkarb2, RII(beta), PKARIIbeta
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 19088
HGNC: HGNC:9392
Homologene: 37666
Utrn
Name: utrophin
Synonyms: G-utrophin, Dmdl, DRP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Mc3r
Name: melanocortin 3 receptor
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17201
HGNC: HGNC:6931
Homologene: 7412
Rgs8
Name: regulator of G-protein signaling 8
Synonyms: 6530413N01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67792
Homologene: 23152
Nfia
Name: nuclear factor I/A
Synonyms: 1110047K16Rik, NF1-A, 9430022M17Rik, NF1A
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18027
HGNC: HGNC:7784
Homologene: 4086
Ptprf
Name: protein tyrosine phosphatase receptor type F
Synonyms: LAR, RPTP-LAR
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19268
HGNC: HGNC:9670
Homologene: 20623
Asah2
Name: N-acylsphingosine amidohydrolase 2
Synonyms: neutral/alkaline ceramidase
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 54447
VEGA: 19
Homologene: 10310
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 86,356,133 bp
  • T to A, chromosome 1 at 120,490,942 bp
  • C to A, chromosome 1 at 153,690,988 bp
  • A to G, chromosome 1 at 171,408,320 bp
  • A to G, chromosome 2 at 26,061,578 bp
  • G to A, chromosome 2 at 37,625,255 bp
  • G to A, chromosome 2 at 52,193,231 bp
  • T to A, chromosome 2 at 86,538,769 bp
  • C to A, chromosome 2 at 90,751,134 bp
  • T to A, chromosome 2 at 122,126,137 bp
  • A to T, chromosome 2 at 172,249,209 bp
  • T to A, chromosome 3 at 36,479,569 bp
  • T to A, chromosome 3 at 64,275,277 bp
  • T to A, chromosome 3 at 82,380,248 bp
  • GTCATCATCATCATCATC to GTCATCATCATCATCATCATC, chromosome 3 at 89,997,940 bp
  • A to G, chromosome 4 at 34,819,549 bp
  • G to T, chromosome 4 at 62,510,122 bp
  • T to A, chromosome 4 at 84,971,173 bp
  • C to A, chromosome 4 at 86,342,324 bp
  • A to G, chromosome 4 at 98,111,251 bp
  • C to A, chromosome 4 at 100,983,556 bp
  • A to T, chromosome 4 at 118,213,629 bp
  • T to A, chromosome 5 at 4,197,666 bp
  • A to T, chromosome 5 at 87,559,826 bp
  • T to C, chromosome 6 at 38,307,340 bp
  • A to T, chromosome 6 at 71,898,408 bp
  • T to G, chromosome 6 at 132,957,676 bp
  • C to T, chromosome 7 at 26,558,337 bp
  • T to C, chromosome 7 at 133,678,714 bp
  • T to C, chromosome 7 at 141,357,833 bp
  • G to T, chromosome 8 at 22,639,995 bp
  • A to G, chromosome 8 at 69,663,913 bp
  • C to T, chromosome 8 at 108,793,503 bp
  • A to G, chromosome 8 at 123,381,437 bp
  • A to C, chromosome 8 at 124,002,975 bp
  • G to A, chromosome 9 at 18,657,176 bp
  • T to A, chromosome 9 at 39,078,083 bp
  • A to T, chromosome 9 at 53,592,066 bp
  • A to G, chromosome 9 at 57,608,263 bp
  • T to C, chromosome 10 at 12,654,716 bp
  • A to T, chromosome 10 at 41,486,877 bp
  • A to G, chromosome 10 at 41,489,348 bp
  • A to G, chromosome 10 at 45,317,919 bp
  • G to T, chromosome 10 at 60,534,535 bp
  • C to A, chromosome 10 at 62,353,058 bp
  • T to C, chromosome 10 at 80,722,927 bp
  • T to C, chromosome 10 at 121,828,730 bp
  • A to G, chromosome 11 at 6,475,150 bp
  • T to C, chromosome 11 at 8,836,267 bp
  • C to T, chromosome 11 at 62,873,519 bp
  • C to A, chromosome 11 at 75,772,586 bp
  • T to A, chromosome 11 at 98,685,665 bp
  • A to T, chromosome 11 at 101,166,570 bp
  • T to C, chromosome 11 at 104,769,655 bp
  • G to T, chromosome 12 at 5,090,995 bp
  • A to T, chromosome 12 at 31,993,758 bp
  • T to A, chromosome 12 at 84,784,852 bp
  • A to T, chromosome 12 at 88,018,361 bp
  • A to T, chromosome 12 at 88,402,132 bp
  • G to T, chromosome 13 at 49,076,345 bp
  • A to G, chromosome 13 at 54,793,298 bp
  • A to G, chromosome 13 at 113,216,667 bp
  • C to A, chromosome 14 at 45,277,481 bp
  • A to G, chromosome 14 at 52,017,811 bp
  • A to G, chromosome 14 at 75,086,174 bp
  • T to A, chromosome 15 at 28,387,833 bp
  • T to C, chromosome 15 at 91,276,116 bp
  • T to C, chromosome 15 at 101,119,072 bp
  • T to A, chromosome 16 at 31,887,476 bp
  • T to C, chromosome 17 at 64,309,090 bp
  • T to G, chromosome 18 at 56,743,276 bp
  • G to T, chromosome 18 at 67,421,259 bp
  • T to C, chromosome 19 at 32,016,514 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6028 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044200-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.