Strain Name:
C57BL/6J-MtgxR6028Btlr
Stock Number:
044200-MU
Citation ID:
RRID:MMRRC_044200-MU
Other Names:
R6028 (G1)
Major Collection:

Gene Information

Prkar2b
Name: protein kinase, cAMP dependent regulatory, type II beta
Synonyms: PKARIIbeta, RII(beta), Pkarb2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 19088
HGNC: HGNC:9392
Homologene: 37666
Utrn
Name: utrophin
Synonyms: G-utrophin, Dmdl, DRP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Mc3r
Name: melanocortin 3 receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 17201
HGNC: HGNC:6931
Homologene: 7412
Rgs8
Name: regulator of G-protein signaling 8
Synonyms: 6530413N01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 67792
Homologene: 23152
Nfia
Name: nuclear factor I/A
Synonyms: NF1-A, 9430022M17Rik, 1110047K16Rik, NF1A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 18027
HGNC: HGNC:7784
Homologene: 4086
Ptprf
Name: protein tyrosine phosphatase, receptor type, F
Synonyms: LAR, RPTP-LAR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 19268
HGNC: HGNC:9670
Homologene: 20623
Asah2
Name: N-acylsphingosine amidohydrolase 2
Synonyms: neutral/alkaline ceramidase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 54447
VEGA: 19
Homologene: 10310
Psmd3
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 3
Synonyms: Psd3, AntP91a, Tstap91a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 22123
HGNC: HGNC:9560
Homologene: 2102
Lmnb1
Name: lamin B1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 16906
HGNC: HGNC:6637
Homologene: 55912
Zfhx3
Name: zinc finger homeobox 3
Synonyms: Sci, Atbf1, A230102L03Rik, WBP9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 11906
HGNC: HGNC:777
Homologene: 21366
Fnbp4
Name: formin binding protein 4
Synonyms: FBP30
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 55935
Homologene: 9087
Zfp292
Name: zinc finger protein 292
Synonyms: 5730450D02Rik, Zn-16, Zn-15, Zfp-15, Krox-10, Zfp15, 9430062L07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 30046
Homologene: 8493
Ptcd3
Name: pentatricopeptide repeat domain 3
Synonyms: 2810422B04Rik, 2610034F17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 69956
Homologene: 41211
Afg3l2
Name: AFG3-like AAA ATPase 2
Synonyms: Emv66, par, 2310036I02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 69597
VEGA: 18
HGNC: HGNC:315
Homologene: 4947
Ap3d1
Name: adaptor-related protein complex 3, delta 1 subunit
Synonyms: Bolvr, mBLVR1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 11776
VEGA: 10
HGNC: HGNC:568
Homologene: 2926
Adamtsl1
Name: ADAMTS-like 1
Synonyms: punctin-1, 5930437A14Rik, 6720426B09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 77739
Homologene: 64642
Lman1l
Name: lectin, mannose-binding 1 like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235416
HGNC: HGNC:6632
Homologene: 11047
Muc16
Name: mucin 16
Synonyms: 1110008I14Rik, LOC385009, Gm21044
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 73732
Homologene: 141193
Hk1
Name: hexokinase 1
Synonyms: Hk-1, Hk1-s, mHk1-s
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 15275
HGNC: HGNC:4922
Homologene: 100530
Ncl
Name: nucleolin
Synonyms: C23, B530004O11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 17975
HGNC: HGNC:7667
Homologene: 136488
Tcf25
Name: transcription factor 25 (basic helix-loop-helix)
Synonyms: D8Ertd325e, 1810041K11Rik, 1100001J13Rik, Nulp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 66855
Homologene: 5701
Pja2
Name: praja ring finger ubiquitin ligase 2
Synonyms: Neurodap1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 224938
Homologene: 32233
Cachd1
Name: cache domain containing 1
Synonyms: Vwcd1, 1190007F10Rik, B430218L07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 320508
Homologene: 10854
Pkd1l1
Name: polycystic kidney disease 1 like 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 171395
Homologene: 51376
Eps8l2
Name: EPS8-like 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 98845
Homologene: 69358
Strbp
Name: spermatid perinuclear RNA binding protein
Synonyms: Spnr, C230082I21Rik, 6430510M02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20744
Homologene: 7548
Cdh23
Name: cadherin 23 (otocadherin)
Synonyms: mdfw, USH1D, ahl, nmf252, nmf181, nmf112, sals, bob, 4930542A03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 22295
Homologene: 11142
Nacc2
Name: nucleus accumbens associated 2, BEN and BTB (POZ) domain containing
Synonyms: 0610020I02Rik, C030048H19Rik, Btbd14a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 67991
Homologene: 75239
Dnah5
Name: dynein, axonemal, heavy chain 5
Synonyms: b2b1154Clo, b2b1537Clo, Dnahc5, b2b3491Clo, b2b1565Clo, Mdnah5, b2b1134Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 110082
HGNC: HGNC:2950
Homologene: 1048
Arhgap30
Name: Rho GTPase activating protein 30
Synonyms: 6030405P05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226652
Homologene: 18766
Marco
Name: macrophage receptor with collagenous structure
Synonyms: Scara2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 17167
HGNC: HGNC:6895
Homologene: 4928
Zc3hav1
Name: zinc finger CCCH type, antiviral 1
Synonyms: 9130009D18Rik, 2900058M19Rik, 9830115L13Rik, 1200014N16Rik, ZAP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 78781
Homologene: 10585
Patl2
Name: protein associated with topoisomerase II homolog 2 (yeast)
Synonyms: Pat1a, 4930424G05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 67578
Homologene: 12155
Nlrp9a
Name: NLR family, pyrin domain containing 9A
Synonyms: Nalp-theta, D7Ertd565e, Nalp9a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233001
Homologene: 116072
Neb
Name: nebulin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 17996
HGNC: HGNC:7720
Homologene: 136285
Taf5l
Name: TATA-box binding protein associated factor 5 like
Synonyms: 1110005N04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 102162
Homologene: 8676
Gm11639
Name: predicted gene 11639
Synonyms: Gm11639, Efcab15
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 105242472
Vmn2r3
Name: vomeronasal 2, receptor 3
Synonyms: EG637004
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 637004
Wnk2
Name: WNK lysine deficient protein kinase 2
Synonyms: X83337, ESTM15, 1810073P09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 75607
Homologene: 19155
Ltbp2
Name: latent transforming growth factor beta binding protein 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 16997
HGNC: HGNC:6715
Homologene: 369
Srgap1
Name: SLIT-ROBO Rho GTPase activating protein 1
Synonyms: Arhgap13, 4930572H05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 117600
Homologene: 56898
Fbxw10
Name: F-box and WD-40 domain protein 10
Synonyms: SM2SH2, SM25H2, Fbw10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 213980
Homologene: 32757
Adck1
Name: aarF domain containing kinase 1
Synonyms: 2610005A10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 72113
VEGA: 12
Homologene: 6493
Cntln
Name: centlein, centrosomal protein
Synonyms: B430108F07Rik, D530005L17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 338349
Homologene: 9805
Map9
Name: microtubule-associated protein 9
Synonyms: 5330427D05Rik, ASAP, Mtap9, 5033421J10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 213582
Homologene: 41591
Plekhh3
Name: pleckstrin homology domain containing, family H (with MyTH4 domain) member 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 217198
Homologene: 11787
Esm1
Name: endothelial cell-specific molecule 1
Synonyms: 0610042H23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 71690
HGNC: HGNC:3466
Homologene: 5107
Doc2b
Name: double C2, beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 13447
HGNC: HGNC:2986
Homologene: 20796
Sult1d1
Name: sulfotransferase family 1D, member 1
Synonyms: Sultn, 5033411P13Rik, tyrosine-ester sulfotransferase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 53315
Homologene: 124464
Polb
Name: polymerase (DNA directed), beta
Synonyms: A430088C08Rik, Pol beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 18970
HGNC: HGNC:9174
Homologene: 2013
Tas2r131
Name: taste receptor, type 2, member 131
Synonyms: Tas2r31, T2R31, mGR31, mt2r61
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 387356
Homologene: 52298
Klhl29
Name: kelch-like 29
Synonyms: A230106N14Rik, Kbtbd9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 208439
VEGA: 12
Homologene: 66272
Slc2a13
Name: solute carrier family 2 (facilitated glucose transporter), member 13
Synonyms: A630029G22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 239606
Homologene: 43139
Lrrc63
Name: leucine rich repeat containing 63
Synonyms: 4921509B22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 70859
Homologene: 52823
Mterf1b
Name: mitochondrial transcription termination factor 1b
Synonyms: Gm9897
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 208595
Homologene: 5073
Popdc3
Name: popeye domain containing 3
Synonyms: Pop3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 78977
Homologene: 32540
Mical1
Name: microtubule associated monooxygenase, calponin and LIM domain containing 1
Synonyms: Nical
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 171580
Homologene: 11246
Tmem253
Name: transmembrane protein 253
Synonyms: G630016D24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 619301
VEGA: 14
Homologene: 83921
Zfp964
Name: zinc finger protein 964
Synonyms: Gm7187
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 636741
Homologene: 130114
Olfr938
Name: olfactory receptor 938
Synonyms: GA_x6K02T2PVTD-32774646-32773699, MOR171-25
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258430
VEGA: 9
Acat1
Name: acetyl-Coenzyme A acetyltransferase 1
Synonyms: Acat, 6330585C21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 110446
HGNC: HGNC:93
Homologene: 6
Mmp21
Name: matrix metallopeptidase 21
Synonyms: b2b2458Clo, b2b873Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 214766
Homologene: 17519
Gpr137c
Name: G protein-coupled receptor 137C
Synonyms: TM7SF1L2, 6330416L11Rik, LOC380893
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 70713
Homologene: 28613
Meltf
Name: melanotransferrin
Synonyms: MTf, CD228, Mfi2, melanotransferrin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 30060
VEGA: 16
HGNC: HGNC:7037
Homologene: 4335
Tspan17
Name: tetraspanin 17
Synonyms: Fbxo23, Tm4sf17, 2210021G21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 74257
Homologene: 41762
Purb
Name: purine rich element binding protein B
Synonyms: D11Bwg0414e, 2310015K15Rik, Cager-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 19291
HGNC: HGNC:9702
Homologene: 69087
Hax1
Name: HCLS1 associated X-1
Synonyms: HAX-1, mHAX-1s, Silg111, HS1-associated protein X-1, Hs1bp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 23897
Homologene: 4463
Smpd2
Name: sphingomyelin phosphodiesterase 2, neutral
Synonyms: nSMase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 20598
Homologene: 31129
Olfr1079
Name: olfactory receptor 1079
Synonyms: GA_x6K02T2Q125-48024195-48023254, MOR189-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258402
Homologene: 74090
Ankrd33
Name: ankyrin repeat domain 33
Synonyms: Panky, A930021G21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 208258
VEGA: 15
Homologene: 16992
1810062G17Rik
Name: RIKEN cDNA 1810062G17 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 72282
Alad
Name: aminolevulinate, delta-, dehydratase
Synonyms: Lv
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 17025
HGNC: HGNC:395
Homologene: 16
Gm6803
Name: predicted gene 6803
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
VEGA: 12
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 86,356,133 bp
  • T to A, chromosome 1 at 120,490,942 bp
  • C to A, chromosome 1 at 153,690,988 bp
  • A to G, chromosome 1 at 171,408,320 bp
  • A to G, chromosome 2 at 26,061,578 bp
  • G to A, chromosome 2 at 37,625,255 bp
  • G to A, chromosome 2 at 52,193,231 bp
  • T to A, chromosome 2 at 86,538,769 bp
  • C to A, chromosome 2 at 90,751,134 bp
  • T to A, chromosome 2 at 122,126,137 bp
  • A to T, chromosome 2 at 172,249,209 bp
  • T to A, chromosome 3 at 36,479,569 bp
  • T to A, chromosome 3 at 64,275,277 bp
  • T to A, chromosome 3 at 82,380,248 bp
  • GTCATCATCATCATCATC to GTCATCATCATCATCATCATC, chromosome 3 at 89,997,940 bp
  • A to G, chromosome 4 at 34,819,549 bp
  • G to T, chromosome 4 at 62,510,122 bp
  • T to A, chromosome 4 at 84,971,173 bp
  • C to A, chromosome 4 at 86,342,324 bp
  • A to G, chromosome 4 at 98,111,251 bp
  • C to A, chromosome 4 at 100,983,556 bp
  • A to T, chromosome 4 at 118,213,629 bp
  • T to A, chromosome 5 at 4,197,666 bp
  • A to T, chromosome 5 at 87,559,826 bp
  • T to C, chromosome 6 at 38,307,340 bp
  • A to T, chromosome 6 at 71,898,408 bp
  • T to G, chromosome 6 at 132,957,676 bp
  • C to T, chromosome 7 at 26,558,337 bp
  • T to C, chromosome 7 at 133,678,714 bp
  • T to C, chromosome 7 at 141,357,833 bp
  • G to T, chromosome 8 at 22,639,995 bp
  • A to G, chromosome 8 at 69,663,913 bp
  • C to T, chromosome 8 at 108,793,503 bp
  • A to G, chromosome 8 at 123,381,437 bp
  • A to C, chromosome 8 at 124,002,975 bp
  • G to A, chromosome 9 at 18,657,176 bp
  • T to A, chromosome 9 at 39,078,083 bp
  • A to T, chromosome 9 at 53,592,066 bp
  • A to G, chromosome 9 at 57,608,263 bp
  • T to C, chromosome 10 at 12,654,716 bp
  • A to T, chromosome 10 at 41,486,877 bp
  • A to G, chromosome 10 at 41,489,348 bp
  • A to G, chromosome 10 at 45,317,919 bp
  • G to T, chromosome 10 at 60,534,535 bp
  • C to A, chromosome 10 at 62,353,058 bp
  • T to C, chromosome 10 at 80,722,927 bp
  • T to C, chromosome 10 at 121,828,730 bp
  • A to G, chromosome 11 at 6,475,150 bp
  • T to C, chromosome 11 at 8,836,267 bp
  • C to T, chromosome 11 at 62,873,519 bp
  • C to A, chromosome 11 at 75,772,586 bp
  • T to A, chromosome 11 at 98,685,665 bp
  • A to T, chromosome 11 at 101,166,570 bp
  • T to C, chromosome 11 at 104,769,655 bp
  • G to T, chromosome 12 at 5,090,995 bp
  • A to T, chromosome 12 at 31,993,758 bp
  • T to A, chromosome 12 at 84,784,852 bp
  • A to T, chromosome 12 at 88,018,361 bp
  • A to T, chromosome 12 at 88,402,132 bp
  • G to T, chromosome 13 at 49,076,345 bp
  • A to G, chromosome 13 at 54,793,298 bp
  • A to G, chromosome 13 at 113,216,667 bp
  • C to A, chromosome 14 at 45,277,481 bp
  • A to G, chromosome 14 at 52,017,811 bp
  • A to G, chromosome 14 at 75,086,174 bp
  • T to A, chromosome 15 at 28,387,833 bp
  • T to C, chromosome 15 at 91,276,116 bp
  • T to C, chromosome 15 at 101,119,072 bp
  • T to A, chromosome 16 at 31,887,476 bp
  • T to C, chromosome 17 at 64,309,090 bp
  • T to G, chromosome 18 at 56,743,276 bp
  • G to T, chromosome 18 at 67,421,259 bp
  • T to C, chromosome 19 at 32,016,514 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6028 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
044200-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.