Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6197Btlr/Mmmh
Stock Number:
044337-MU
Citation ID:
RRID:MMRRC_044337-MU
Other Names:
R6197 (G1)
Major Collection:

Strain Information

Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Tanc1
Name: tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
Synonyms: 1200003E16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66860
Homologene: 18946
Rarg
Name: retinoic acid receptor, gamma
Synonyms: RARgamma2, RAR gamma 2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 19411
HGNC: HGNC:9866
Homologene: 20263
Ylpm1
Name: YLP motif containing 1
Synonyms: ZAP, Zap3, A930013E17Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56531
Homologene: 87707
Cltc
Name: clathrin heavy chain
Synonyms: CHC
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67300
HGNC: HGNC:2092
Homologene: 3572
Virma
Name: vir like m6A methyltransferase associated
Synonyms: 1110037F02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66185
Homologene: 41043
Adgrl2
Name: adhesion G protein-coupled receptor L2
Synonyms: Lphh1, Lec1, Lphn2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99633
Homologene: 22712
Cc2d1b
Name: coiled-coil and C2 domain containing 1B
Synonyms: A830039B04Rik, Freud2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 319965
Homologene: 70951
Supt16
Name: SPT16, facilitates chromatin remodeling subunit
Synonyms: Cdc68, Fact140, Spt16, Supt16h
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 114741
VEGA: 14
Homologene: 5207
Zfp617
Name: zinc finger protein 617
Synonyms: Zfps11-6, Zinc finger protein s11-6
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 170938
Homologene: 135689
Slc22a3
Name: solute carrier family 22 (organic cation transporter), member 3
Synonyms: EMT, Oct3, Orct3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20519
VEGA: 17
Homologene: 22630
Rcc1
Name: regulator of chromosome condensation 1
Synonyms: 4931417M11Rik, Chc1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100088
HGNC: HGNC:1913
Homologene: 55567
Cacna2d3
Name: calcium channel, voltage-dependent, alpha2/delta subunit 3
Synonyms: alpha 2 delta-3, alpha2delta3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12294
Homologene: 74929
Pwwp2a
Name: PWWP domain containing 2A
Synonyms: D930040F23Rik, 4631424J17Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70802
Homologene: 19687
Nup54
Name: nucleoporin 54
Synonyms: 3110079L04Rik, 54kDa
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269113
Homologene: 41169
Mtus1
Name: mitochondrial tumor suppressor 1
Synonyms: MD44, MTSG1, Atip1, B430305I03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102103
Homologene: 100292
Nbeal1
Name: neurobeachin like 1
Synonyms: A530050O19Rik, ALS2CR17, A530083I02Rik, 2310076G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269198
Homologene: 16453
Csmd1
Name: CUB and Sushi multiple domains 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 94109
Homologene: 69536
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Hoxd4
Name: homeobox D4
Synonyms: Hox-5.1, Hox-4.2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 15436
HGNC: HGNC:5138
Homologene: 7773
Dnah11
Name: dynein, axonemal, heavy chain 11
Synonyms: lrd, b2b1279Clo, b2b1203Clo, b2b598Clo, b2b1289Clo, b2b1727Clo, Dnahc11, avc4
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13411
HGNC: HGNC:2942
Homologene: 2801
Rubcnl
Name: RUN and cysteine rich domain containing beclin 1 interacting protein like
Synonyms: LOC380917, 5031414D18Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 271221
VEGA: 14
Homologene: 57021
Col6a3
Name: collagen, type VI, alpha 3
Synonyms: Col6a-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12835
HGNC: HGNC:2213
Homologene: 37917
Prss59
Name: serine protease 59
Synonyms: 1700074P13Rik, Tryx5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 73481
Homologene: 49905
Myh1
Name: myosin, heavy polypeptide 1, skeletal muscle, adult
Synonyms: MyHC-IId/x, Myhs-f2, Myhs-f, Myhsf2, A530084A17Rik, MYHC-IIX, myosin heavy chain 2X, IId, IId/x
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17879
HGNC: HGNC:7567
Homologene: 133718
Abcb9
Name: ATP-binding cassette, sub-family B member 9
Synonyms: TAPL
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56325
HGNC: HGNC:50
Homologene: 10491
Ak9
Name: adenylate kinase 9
Synonyms: LOC215946, Akd2, Gm7127, Akd1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 633979
Homologene: 67934
Ripk2
Name: receptor (TNFRSF)-interacting serine-threonine kinase 2
Synonyms: CCK, CARDIAK, RIP2, RICK, CARD3, D4Bwg0615e, 2210420D18Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 192656
Homologene: 37856
Slco6c1
Name: solute carrier organic anion transporter family, member 6c1
Synonyms: 4933404A18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74441
Homologene: 65259
Pramel23
Name: PRAME like 23
Synonyms: Gm13089
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 277667
Als2cl
Name: ALS2 C-terminal like
Synonyms: mRn.49018, D930044G19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235633
Homologene: 17152
Atp11a
Name: ATPase, class VI, type 11A
Synonyms: Ih, 4930558F19Rik, 9130422H11Rik, LOC100045280
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 50770
Homologene: 75050
Usp4
Name: ubiquitin specific peptidase 4 (proto-oncogene)
Synonyms: Unp, F730026I20Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22258
Homologene: 20716
Sncaip
Name: synuclein, alpha interacting protein (synphilin)
Synonyms: 4933427B05Rik, SYPH1, synphilin-1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67847
Homologene: 3987
Cpt1b
Name: carnitine palmitoyltransferase 1b, muscle
Synonyms: M-CPTI, M-CPT I, Cpt1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12895
HGNC: HGNC:2329
Homologene: 22548
Or7a37
Name: olfactory receptor family 7 subfamily A member 37
Synonyms: GA_x6K02T2QGN0-2842591-2841662, MOR139-2, Olfr1353
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 259044
HGNC: HGNC:8370
Homologene: 131345
Ces1g
Name: carboxylesterase 1G
Synonyms: Ces-1, Ses-1, Ces1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12623
Homologene: 137354
Gpx2
Name: glutathione peroxidase 2
Synonyms: GPx-GI, intestinal GPx, GI-GPx
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 14776
VEGA: 12
HGNC: HGNC:4554
Homologene: 20479
Eny2
Name: ENY2 transcription and export complex 2 subunit
Synonyms: 1810057B09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223527
VEGA: 15
Homologene: 10612
Or5w17
Name: olfactory receptor family 5 subfamily W member 17
Synonyms: GA_x6K02T2Q125-49257818-49256883, MOR177-10, Olfr1141
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258630
Homologene: 74080
Usp49
Name: ubiquitin specific peptidase 49
Synonyms: C330046L10Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224836
Homologene: 10235
Vmn1r234
Name: vomeronasal 1 receptor 234
Synonyms: V1rf1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 171232
Or10v9
Name: olfactory receptor family 10 subfamily V member 9
Synonyms: GA_x6K02T2RE5P-2207258-2206302, MOR266-5, Olfr1418
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258227
Homologene: 79372
Hoxd9
Name: homeobox D9
Synonyms: Hox-5.2, Hox-4.4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 15438
HGNC: HGNC:5140
Homologene: 8409
Rragc
Name: Ras-related GTP binding C
Synonyms: YGR163W, TIB929, Gtr2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 54170
Homologene: 39141
Or4c124
Name: olfactory receptor family 4 subfamily C member 124
Synonyms: GA_x6K02T2Q125-50770831-50769896, MOR233-18, Olfr1232
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258320
Homologene: 74068
Cnbd2
Name: cyclic nucleotide binding domain containing 2
Synonyms: 5430421B09Rik, 4921517L17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70873
Homologene: 15440
Fbxo10
Name: F-box protein 10
Synonyms: FBX10, LOC269529
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269529
Homologene: 19544
Sephs2
Name: selenophosphate synthetase 2
Synonyms: Ysg3, Sps2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20768
Homologene: 7550
1700109H08Rik
Name: RIKEN cDNA 1700109H08 gene
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77036
Homologene: 130776
H2-Q5
Name: histocompatibility 2, Q region locus 5
Synonyms: H-2Q5, Qa-5, Qat-5, Qa5
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15016
Cd37
Name: CD37 antigen
Synonyms: Tspan26
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12493
HGNC: HGNC:1666
Homologene: 20422
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 60,222,128 bp
  • A to T, chromosome 1 at 90,822,341 bp
  • A to G, chromosome 1 at 97,072,793 bp
  • G to A, chromosome 2 at 59,844,022 bp
  • A to G, chromosome 2 at 74,698,822 bp
  • A to G, chromosome 2 at 74,728,463 bp
  • C to T, chromosome 2 at 87,753,352 bp
  • A to T, chromosome 2 at 89,325,333 bp
  • A to G, chromosome 2 at 156,375,574 bp
  • AAACCCTA to AA, chromosome 2 at 177,509,655 bp
  • T to C, chromosome 3 at 148,858,942 bp
  • A to G, chromosome 4 at 11,505,498 bp
  • A to G, chromosome 4 at 16,163,330 bp
  • G to T, chromosome 4 at 45,043,857 bp
  • C to T, chromosome 4 at 108,633,225 bp
  • A to G, chromosome 4 at 123,452,292 bp
  • A to G, chromosome 4 at 123,917,547 bp
  • T to C, chromosome 4 at 132,337,762 bp
  • T to C, chromosome 4 at 143,697,316 bp
  • T to A, chromosome 5 at 3,580,442 bp
  • TCTGCTGCTGCTGCTGCTGCTGCTG to TCTGCTGCTGCTGCTGCTGCTG, chromosome 5 at 92,430,804 bp
  • C to A, chromosome 5 at 124,071,749 bp
  • GC to GCTCC, chromosome 6 at 4,756,452 bp
  • A to G, chromosome 6 at 40,921,005 bp
  • A to G, chromosome 7 at 45,237,174 bp
  • A to T, chromosome 7 at 127,272,901 bp
  • A to G, chromosome 8 at 12,846,099 bp
  • A to G, chromosome 8 at 15,926,611 bp
  • A to G, chromosome 8 at 41,084,037 bp
  • T to A, chromosome 8 at 71,933,254 bp
  • T to C, chromosome 8 at 93,337,136 bp
  • C to A, chromosome 9 at 108,370,955 bp
  • A to G, chromosome 9 at 110,895,884 bp
  • T to A, chromosome 10 at 23,856,289 bp
  • T to G, chromosome 10 at 41,317,830 bp
  • T to G, chromosome 10 at 78,970,140 bp
  • A to G, chromosome 11 at 43,704,596 bp
  • C to T, chromosome 11 at 67,220,967 bp
  • T to C, chromosome 11 at 86,720,362 bp
  • C to T, chromosome 12 at 76,795,294 bp
  • A to G, chromosome 12 at 85,042,179 bp
  • T to C, chromosome 12 at 118,179,747 bp
  • A to T, chromosome 14 at 28,908,321 bp
  • G to A, chromosome 14 at 52,170,881 bp
  • G to A, chromosome 14 at 75,031,929 bp
  • T to A, chromosome 15 at 44,429,553 bp
  • T to C, chromosome 15 at 89,424,834 bp
  • A to T, chromosome 15 at 102,241,892 bp
  • C to T, chromosome 17 at 12,458,551 bp
  • G to A, chromosome 17 at 21,229,327 bp
  • G to T, chromosome 17 at 35,394,942 bp
  • T to A, chromosome 17 at 47,673,347 bp
  • T to G, chromosome 18 at 52,906,894 bp
  • G to A, chromosome 18 at 60,916,651 bp
  • G to T, chromosome 19 at 11,855,784 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6197 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044337-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.