Strain Name:
C57BL/6J-MtgxR6258Btlr
Stock Number:
044375-MU
Citation ID:
RRID:MMRRC_044375-MU
Other Names:
R6258 (G1)
Major Collection:

Strain Information

Map2k5
Name: mitogen-activated protein kinase kinase 5
Synonyms: MEK5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 23938
VEGA: 9
HGNC: HGNC:6845
Homologene: 115933
Map4k5
Name: mitogen-activated protein kinase kinase kinase kinase 5
Synonyms: 4432415E19Rik, MAPKKKK5, KHS, GCKR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 399510
HGNC: HGNC:6867
Homologene: 38199
Trdmt1
Name: tRNA aspartic acid methyltransferase 1
Synonyms: Rnmt2, Dnmt2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 13434
HGNC: HGNC:2977
Homologene: 3249
Plin2
Name: perilipin 2
Synonyms: Adrp, ADPH, Adfp, adipophilin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 11520
HGNC: HGNC:248
Homologene: 872
Gaa
Name: glucosidase, alpha, acid
Synonyms: E430018M07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 14387
HGNC: HGNC:4065
Homologene: 37268
Mef2c
Name: myocyte enhancer factor 2C
Synonyms: 5430401D19Rik, 9930028G15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 17260
HGNC: HGNC:6996
Homologene: 31087
Nisch
Name: nischarin
Synonyms: 1200007D05Rik, edsn, 3202002H23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 64652
Homologene: 136161
Wdfy3
Name: WD repeat and FYVE domain containing 3
Synonyms: Ggtb3, 2610509D04Rik, Alfy, Bwf1, D5Ertd66e, Bchs
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 72145
Homologene: 22855
Nf1
Name: neurofibromin 1
Synonyms: neurofibromin, Nf-1, Mhdadsk9, Dsk9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 18015
HGNC: HGNC:7765
Homologene: 226
Smc3
Name: structural maintenance of chromosomes 3
Synonyms: Cspg6, Bamacan, Mmip1, SmcD
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 13006
HGNC: HGNC:2468
Homologene: 3974
Snrnp200
Name: small nuclear ribonucleoprotein 200 (U5)
Synonyms: A330064G03Rik, HELIC2, U5-200KD, Ascc3l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 320632
Homologene: 5859
Ung
Name: uracil DNA glycosylase
Synonyms: UNG1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 22256
Homologene: 6585
Ercc6
Name: excision repair cross-complementing rodent repair deficiency, complementation group 6
Synonyms: C130058G22Rik, CS group B correcting gene, CSB
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 319955
VEGA: 14
HGNC: HGNC:3438
Homologene: 133552
Mical3
Name: microtubule associated monooxygenase, calponin and LIM domain containing 3
Synonyms: MICAL-3, C130040D16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 194401
Homologene: 85288
Cdc73
Name: cell division cycle 73, Paf1/RNA polymerase II complex component
Synonyms: 8430414L16Rik, Hrpt2, C130030P16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 214498
Homologene: 11571
Clcc1
Name: chloride channel CLIC-like 1
Synonyms: Mclc
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229725
Homologene: 9032
Fgd6
Name: FYVE, RhoGEF and PH domain containing 6
Synonyms: ZFYVE24, Etohd4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 13998
Homologene: 14209
Dab1
Name: disabled 1
Synonyms: C630028C02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 13131
HGNC: HGNC:2661
Homologene: 32084
Casr
Name: calcium-sensing receptor
Synonyms: CaR, cation sensing receptor, Gprc2a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 12374
HGNC: HGNC:1514
Homologene: 332
Alms1
Name: ALMS1, centrosome and basal body associated
Synonyms: Alstrom syndrome 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 236266
HGNC: HGNC:428
Homologene: 49406
Gm4924
Name: predicted gene 4924
Synonyms: mIF1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 237412
Ubr3
Name: ubiquitin protein ligase E3 component n-recognin 3
Synonyms: 4833421P10Rik, Zfp650, A130030D10Rik, 1110059H15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 68795
Homologene: 52092
Lgr6
Name: leucine-rich repeat-containing G protein-coupled receptor 6
Synonyms: A530037C04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 329252
Homologene: 49680
Ctsa
Name: cathepsin A
Synonyms: PPCA, Ppgb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 19025
HGNC: HGNC:9251
Homologene: 80163
Cdc7
Name: cell division cycle 7 (S. cerevisiae)
Synonyms: Cdc7, muCdc7, Cdc7l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 12545
HGNC: HGNC:1745
Homologene: 31166
Vezf1
Name: vascular endothelial zinc finger 1
Synonyms: db1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 22344
Homologene: 5175
Eml2
Name: echinoderm microtubule associated protein like 2
Synonyms: 1600029N02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 72205
Homologene: 8125
Lins1
Name: lines homolog 1
Synonyms: Wins2, Lins, 2700083B01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 72635
Homologene: 10034
Magi3
Name: membrane associated guanylate kinase, WW and PDZ domain containing 3
Synonyms: 6530407C02Rik, 4732496O19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 99470
Homologene: 26431
Tcerg1
Name: transcription elongation regulator 1 (CA150)
Synonyms: p144, 2410022J09Rik, ca150, 2900090C16Rik, Taf2s, Fbp28
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 56070
Homologene: 4879
AU041133
Name: expressed sequence AU041133
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 216177
Homologene: 87560
Sucnr1
Name: succinate receptor 1
Synonyms: Gpr91
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 84112
HGNC: HGNC:4542
Homologene: 41865
Adamtsl3
Name: ADAMTS-like 3
Synonyms: 9230119C12Rik, punctin-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 269959
Homologene: 18912
Cntn3
Name: contactin 3
Synonyms: Pang
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 18488
HGNC: HGNC:2173
Homologene: 7461
Dnah17
Name: dynein, axonemal, heavy chain 17
Synonyms: LOC382552, 2810003K23Rik, Dnahcl1, Dnahc17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 69926
HGNC: HGNC:2946
Homologene: 72102
Slc6a18
Name: solute carrier family 6 (neurotransmitter transporter), member 18
Synonyms: XT2, D630001K16Rik, Xtrp2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 22598
VEGA: 13
Homologene: 40785
Psma8
Name: proteasome subunit alpha 8
Synonyms: 2410072D24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 73677
VEGA: 18
Homologene: 2086
Krtcap3
Name: keratinocyte associated protein 3
Synonyms: 2010001C09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 69815
Homologene: 12332
Itgb4
Name: integrin beta 4
Synonyms: CD104
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 192897
HGNC: HGNC:6158
Homologene: 179
Ryr3
Name: ryanodine receptor 3
Synonyms: calcium release channel isoform 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20192
Homologene: 68151
Carmil3
Name: capping protein regulator and myosin 1 linker 3
Synonyms: Lrrc16b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 268747
VEGA: 14
Homologene: 74564
Jakmip1
Name: janus kinase and microtubule interacting protein 1
Synonyms: C330021K24Rik, 5830437M04Rik, Gababrbp, Marlin-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 76071
Homologene: 90789
Egflam
Name: EGF-like, fibronectin type III and laminin G domains
Synonyms: nectican, pikachurin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 268780
Homologene: 65044
Tbc1d9
Name: TBC1 domain family, member 9
Synonyms: 4933431N12Rik, C76116
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 71310
Homologene: 57079
Slc28a2b
Name: solute carrier family 28 member 2b
Synonyms: Gm14085
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 381417
Pla2g4a
Name: phospholipase A2, group IVA (cytosolic, calcium-dependent)
Synonyms: Type IV PLA2, Pla2g4, cytosolic phospholipase A2, cytosolic PLA2, cPLA2, cPLA2alpha
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 18783
HGNC: HGNC:9035
Homologene: 32059
Fbxo41
Name: F-box protein 41
Synonyms: D6Ertd538e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 330369
Homologene: 19837
Cyp2s1
Name: cytochrome P450, family 2, subfamily s, polypeptide 1
Synonyms: 1200011C15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 74134
Homologene: 75274
Thsd7b
Name: thrombospondin, type I, domain containing 7B
Synonyms: 1700074E13Rik, D130067I03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 210417
Homologene: 18180
Alppl2
Name: alkaline phosphatase, placental-like 2
Synonyms: Akp5, D1Ertd816e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 11650
Homologene: 129600
Or4f15
Name: olfactory receptor family 4 subfamily F member 15
Synonyms: MOR245-5, GA_x6K02T2Q125-73031456-73030518, Olfr1309
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 258439
Homologene: 74054
Pcdhb12
Name: protocadherin beta 12
Synonyms: PcdhbL, Pcdh3, Pcdhb5F
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93883
HGNC: HGNC:8690
Homologene: 87126
Pde7b
Name: phosphodiesterase 7B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 29863
HGNC: HGNC:8792
Homologene: 32194
Pdzrn4
Name: PDZ domain containing RING finger 4
Synonyms: 1110017D07Rik, LNX4, SAMCAP3L
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 239618
VEGA: 15
Homologene: 85433
Spdl1
Name: spindle apparatus coiled-coil protein 1
Synonyms: 2810049B11Rik, Ccdc99, 2600001J17Rik, 1700018I02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 70385
Homologene: 9837
Zfp709
Name: zinc finger protein 709
Synonyms: GIOT-4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 236193
Homologene: 136795
Zfp1007
Name: zinc finger protein 1007
Synonyms: 5430403G16Rik, ENSMUSG00000072763
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 77200
Crocc2
Name: ciliary rootlet coiled-coil, rootletin family member 2
Synonyms: E030010N08Rik, LOC381284
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 381284
Homologene: 141152
Erg
Name: ETS transcription factor
Synonyms: D030036I24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 13876
HGNC: HGNC:3446
Homologene: 15848
Klhl40
Name: kelch-like 40
Synonyms: Kbtbd5, 2310024D23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 72330
VEGA: 9
Homologene: 17571
Rcor3
Name: REST corepressor 3
Synonyms: C730034D20Rik, E130101E15Rik, 4921514E24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 214742
Homologene: 135671
Samm50
Name: SAMM50 sorting and assembly machinery component
Synonyms: 1110030L07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 68653
VEGA: 15
Homologene: 41034
Fbxw2
Name: F-box and WD-40 domain protein 2
Synonyms: FBW2, MD6, Fwd2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 30050
Homologene: 8131
Gm8369
Name: predicted gene 8369
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 666926
Rptn
Name: repetin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 20129
Homologene: 84780
H2-M10.1
Name: histocompatibility 2, M region locus 10.1
Synonyms: 9.5H
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 14985
Homologene: 117973
Methig1
Name: methyltransferase hypoxia inducible domain containing 1
Synonyms: UbiE-YGHL1, UbiE2-Hig1-4, AB099516, Mettl7a2Higd1c, Mettl7a2-Higd1c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 554292
Homologene: 128515
Or5p61
Name: olfactory receptor family 5 subfamily P member 61
Synonyms: MOR204-30P, MOR204-40_p, Olfr485, GA_x6K02T2PBJ9-10489044-10488091
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258041
Homologene: 110483
Sord
Name: sorbitol dehydrogenase
Synonyms: Sodh-1, Sdh-1, Sdh1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20322
Homologene: 56080
Wdr97
Name: WD repeat domain 97
Synonyms: Gm35339
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 102638882
Homologene: 131539
Zscan4-ps1
Name: zinc finger and SCAN domain containing 4, pseudogene 1
Synonyms: EG545912
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 545912
Gm32742
Name: predicted gene, 32742
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 102635385
Homologene: 132734
Faiml
Name: Fas apoptotic inhibitory molecule like
Synonyms: Gm6432
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 623459
Ighv5-8
Name: immunoglobulin heavy variable V5-8
Synonyms: Gm17309
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 777782
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 87,088,462 bp
  • A to G, chromosome 1 at 93,213,638 bp
  • A to G, chromosome 1 at 129,667,918 bp
  • C to T, chromosome 1 at 134,994,010 bp
  • G to A, chromosome 1 at 143,691,473 bp
  • A to G, chromosome 1 at 149,857,487 bp
  • G to A, chromosome 1 at 192,124,259 bp
  • T to A, chromosome 2 at 13,520,059 bp
  • A to T, chromosome 2 at 34,812,813 bp
  • A to G, chromosome 2 at 69,982,864 bp
  • C to T, chromosome 2 at 111,984,051 bp
  • A to G, chromosome 2 at 112,660,104 bp
  • T to A, chromosome 2 at 122,259,132 bp
  • A to T, chromosome 2 at 122,523,482 bp
  • G to A, chromosome 2 at 127,218,423 bp
  • T to C, chromosome 2 at 164,834,361 bp
  • T to C, chromosome 3 at 60,086,357 bp
  • C to G, chromosome 3 at 93,398,130 bp
  • A to G, chromosome 3 at 104,089,596 bp
  • G to A, chromosome 3 at 108,673,308 bp
  • G to T, chromosome 4 at 86,657,289 bp
  • C to T, chromosome 4 at 104,731,751 bp
  • A to T, chromosome 5 at 31,252,228 bp
  • G to T, chromosome 5 at 37,141,760 bp
  • C to T, chromosome 5 at 101,872,965 bp
  • A to G, chromosome 5 at 106,969,227 bp
  • T to C, chromosome 5 at 109,676,567 bp
  • A to T, chromosome 5 at 114,137,300 bp
  • A to T, chromosome 6 at 85,478,555 bp
  • A to T, chromosome 6 at 85,628,735 bp
  • A to G, chromosome 6 at 102,277,217 bp
  • A to T, chromosome 6 at 121,009,030 bp
  • C to A, chromosome 7 at 11,065,902 bp
  • T to G, chromosome 7 at 19,179,364 bp
  • ACAGCAGCAGCAGCAGCAGCAGCAG to ACAGCAGCAGCAGCAGCAGCAG, chromosome 7 at 25,816,442 bp
  • T to C, chromosome 7 at 66,710,748 bp
  • T to C, chromosome 7 at 82,528,983 bp
  • T to C, chromosome 7 at 108,158,974 bp
  • TCGACG to TCG, chromosome 8 at 71,890,708 bp
  • T to C, chromosome 8 at 83,210,516 bp
  • T to A, chromosome 9 at 51,157,562 bp
  • T to A, chromosome 9 at 63,217,365 bp
  • T to C, chromosome 9 at 99,232,460 bp
  • T to C, chromosome 9 at 121,777,960 bp
  • T to C, chromosome 10 at 20,440,800 bp
  • A to G, chromosome 10 at 82,151,158 bp
  • T to G, chromosome 10 at 82,377,473 bp
  • T to A, chromosome 10 at 94,044,299 bp
  • T to A, chromosome 11 at 34,819,886 bp
  • A to T, chromosome 11 at 79,565,755 bp
  • A to G, chromosome 11 at 88,081,500 bp
  • C to T, chromosome 11 at 115,984,157 bp
  • C to A, chromosome 11 at 118,126,322 bp
  • C to T, chromosome 11 at 118,126,323 bp
  • A to T, chromosome 11 at 118,126,324 bp
  • C to A, chromosome 11 at 119,281,171 bp
  • C to A, chromosome 12 at 69,831,562 bp
  • A to G, chromosome 12 at 113,654,991 bp
  • A to T, chromosome 13 at 73,670,045 bp
  • T to A, chromosome 13 at 83,652,938 bp
  • T to A, chromosome 14 at 31,177,128 bp
  • T to A, chromosome 14 at 32,557,856 bp
  • T to A, chromosome 14 at 55,500,432 bp
  • T to A, chromosome 15 at 7,234,292 bp
  • C to A, chromosome 15 at 76,355,695 bp
  • C to G, chromosome 15 at 84,200,311 bp
  • C to A, chromosome 15 at 84,200,312 bp
  • A to T, chromosome 15 at 92,757,681 bp
  • T to C, chromosome 15 at 100,353,541 bp
  • A to G, chromosome 16 at 36,517,609 bp
  • C to A, chromosome 16 at 95,380,241 bp
  • T to A, chromosome 17 at 36,324,102 bp
  • A to G, chromosome 18 at 14,721,267 bp
  • T to C, chromosome 18 at 37,436,839 bp
  • T to A, chromosome 18 at 42,553,465 bp
  • G to A, chromosome 19 at 11,511,609 bp
  • T to A, chromosome 19 at 53,627,731 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6258 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044375-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.