Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6258Btlr/Mmmh
Stock Number:
044375-MU
Citation ID:
RRID:MMRRC_044375-MU
Other Names:
R6258 (G1)
Major Collection:

Strain Information

Map2k5
Name: mitogen-activated protein kinase kinase 5
Synonyms: MEK5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 23938
VEGA: 9
HGNC: HGNC:6845
Homologene: 115933
Map4k5
Name: mitogen-activated protein kinase kinase kinase kinase 5
Synonyms: MAPKKKK5, GCKR, KHS, 4432415E19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 399510
HGNC: HGNC:6867
Homologene: 38199
Trdmt1
Name: tRNA aspartic acid methyltransferase 1
Synonyms: Rnmt2, Dnmt2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13434
HGNC: HGNC:2977
Homologene: 3249
Plin2
Name: perilipin 2
Synonyms: Adrp, adipophilin, ADPH, Adfp
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11520
HGNC: HGNC:248
Homologene: 872
Gaa
Name: glucosidase, alpha, acid
Synonyms: E430018M07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14387
HGNC: HGNC:4065
Homologene: 37268
Mef2c
Name: myocyte enhancer factor 2C
Synonyms: 9930028G15Rik, 5430401D19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17260
HGNC: HGNC:6996
Homologene: 31087
Nisch
Name: nischarin
Synonyms: 1200007D05Rik, 3202002H23Rik, edsn
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 64652
Homologene: 136161
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 87,088,462 bp
  • A to G, chromosome 1 at 93,213,638 bp
  • A to G, chromosome 1 at 129,667,918 bp
  • C to T, chromosome 1 at 134,994,010 bp
  • G to A, chromosome 1 at 143,691,473 bp
  • A to G, chromosome 1 at 149,857,487 bp
  • G to A, chromosome 1 at 192,124,259 bp
  • T to A, chromosome 2 at 13,520,059 bp
  • A to T, chromosome 2 at 34,812,813 bp
  • A to G, chromosome 2 at 69,982,864 bp
  • C to T, chromosome 2 at 111,984,051 bp
  • A to G, chromosome 2 at 112,660,104 bp
  • T to A, chromosome 2 at 122,259,132 bp
  • A to T, chromosome 2 at 122,523,482 bp
  • G to A, chromosome 2 at 127,218,423 bp
  • T to C, chromosome 2 at 164,834,361 bp
  • T to C, chromosome 3 at 60,086,357 bp
  • C to G, chromosome 3 at 93,398,130 bp
  • A to G, chromosome 3 at 104,089,596 bp
  • G to A, chromosome 3 at 108,673,308 bp
  • G to T, chromosome 4 at 86,657,289 bp
  • C to T, chromosome 4 at 104,731,751 bp
  • A to T, chromosome 5 at 31,252,228 bp
  • G to T, chromosome 5 at 37,141,760 bp
  • C to T, chromosome 5 at 101,872,965 bp
  • A to G, chromosome 5 at 106,969,227 bp
  • T to C, chromosome 5 at 109,676,567 bp
  • A to T, chromosome 5 at 114,137,300 bp
  • A to T, chromosome 6 at 85,478,555 bp
  • A to T, chromosome 6 at 85,628,735 bp
  • A to G, chromosome 6 at 102,277,217 bp
  • A to T, chromosome 6 at 121,009,030 bp
  • C to A, chromosome 7 at 11,065,902 bp
  • T to G, chromosome 7 at 19,179,364 bp
  • ACAGCAGCAGCAGCAGCAGCAGCAG to ACAGCAGCAGCAGCAGCAGCAG, chromosome 7 at 25,816,442 bp
  • T to C, chromosome 7 at 66,710,748 bp
  • T to C, chromosome 7 at 82,528,983 bp
  • T to C, chromosome 7 at 108,158,974 bp
  • TCGACG to TCG, chromosome 8 at 71,890,708 bp
  • T to C, chromosome 8 at 83,210,516 bp
  • T to A, chromosome 9 at 51,157,562 bp
  • T to A, chromosome 9 at 63,217,365 bp
  • T to C, chromosome 9 at 99,232,460 bp
  • T to C, chromosome 9 at 121,777,960 bp
  • T to C, chromosome 10 at 20,440,800 bp
  • A to G, chromosome 10 at 82,151,158 bp
  • T to G, chromosome 10 at 82,377,473 bp
  • T to A, chromosome 10 at 94,044,299 bp
  • T to A, chromosome 11 at 34,819,886 bp
  • A to T, chromosome 11 at 79,565,755 bp
  • A to G, chromosome 11 at 88,081,500 bp
  • C to T, chromosome 11 at 115,984,157 bp
  • C to A, chromosome 11 at 118,126,322 bp
  • C to T, chromosome 11 at 118,126,323 bp
  • A to T, chromosome 11 at 118,126,324 bp
  • C to A, chromosome 11 at 119,281,171 bp
  • C to A, chromosome 12 at 69,831,562 bp
  • A to G, chromosome 12 at 113,654,991 bp
  • A to T, chromosome 13 at 73,670,045 bp
  • T to A, chromosome 13 at 83,652,938 bp
  • T to A, chromosome 14 at 31,177,128 bp
  • T to A, chromosome 14 at 32,557,856 bp
  • T to A, chromosome 14 at 55,500,432 bp
  • T to A, chromosome 15 at 7,234,292 bp
  • C to A, chromosome 15 at 76,355,695 bp
  • C to G, chromosome 15 at 84,200,311 bp
  • C to A, chromosome 15 at 84,200,312 bp
  • A to T, chromosome 15 at 92,757,681 bp
  • T to C, chromosome 15 at 100,353,541 bp
  • A to G, chromosome 16 at 36,517,609 bp
  • C to A, chromosome 16 at 95,380,241 bp
  • T to A, chromosome 17 at 36,324,102 bp
  • A to G, chromosome 18 at 14,721,267 bp
  • T to C, chromosome 18 at 37,436,839 bp
  • T to A, chromosome 18 at 42,553,465 bp
  • G to A, chromosome 19 at 11,511,609 bp
  • T to A, chromosome 19 at 53,627,731 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6258 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044375-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.