Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6490Btlr/Mmmh
Stock Number:
044622-MU
Citation ID:
RRID:MMRRC_044622-MU
Other Names:
R6490 (G1)
Major Collection:

Strain Information

Wrn
Name: Werner syndrome RecQ like helicase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22427
Homologene: 6659
Stam2
Name: signal transducing adaptor molecule (SH3 domain and ITAM motif) 2
Synonyms: Hbp, 1200004O12Rik, 5730456G07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56324
Homologene: 68490
Mlst8
Name: MTOR associated protein, LST8 homolog (S. cerevisiae)
Synonyms: 0610033N12Rik, mLST8, Gbl
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 56716
VEGA: 17
Homologene: 6833
Adam23
Name: a disintegrin and metallopeptidase domain 23
Synonyms: MDC3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23792
HGNC: HGNC:202
Homologene: 2826
Kif20a
Name: kinesin family member 20A
Synonyms: Rabkinesin-6, Rab6kifl
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 19348
VEGA: 18
HGNC: HGNC:9787
Homologene: 38093
Agrn
Name: agrin
Synonyms: NMF380, Agrin, nmf380
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11603
HGNC: HGNC:329
Homologene: 27907
Papola
Name: poly (A) polymerase alpha
Synonyms: Plap, PapIII
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18789
Homologene: 23389
Ell
Name: elongation factor RNA polymerase II
Synonyms: Men, Ell1, eleven-nineteen lysine-rich leukemia gene
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13716
Homologene: 4762
Vps53
Name: VPS53 GARP complex subunit
Synonyms: 2310040I21Rik, 2010002A08Rik, 3100002B05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68299
Homologene: 6264
Zc3h13
Name: zinc finger CCCH type containing 13
Synonyms: C87618, 4930570G11Rik, 2600010B19Rik, 3110050K21Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67302
VEGA: 14
Zfp619
Name: zinc finger protein 619
Synonyms: 3000002G13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70227
Homologene: 133818
Tbl1xr1
Name: transducin (beta)-like 1X-linked receptor 1
Synonyms: Ira1, TBLR1, DC42, C21, C230089I12Rik, A630076E03Rik, 8030499H02Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 81004
Homologene: 69382
Tmem43
Name: transmembrane protein 43
Synonyms: 1200015A22Rik, LUMA
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74122
Homologene: 11532
Kank1
Name: KN motif and ankyrin repeat domains 1
Synonyms: D330024H06Rik, A930031B09Rik, Ankrd15
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107351
Homologene: 17706
Sbf1
Name: SET binding factor 1
Synonyms: 2610510A08Rik, Mtmr5, B230113C15Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 77980
Homologene: 84710
Galnt14
Name: polypeptide N-acetylgalactosaminyltransferase 14
Synonyms: 0610033M06Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71685
Homologene: 56997
Igfl3
Name: IGF-like family member 3
Synonyms: LOC232925, Igfl
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232925
Homologene: 74410
Oit3
Name: oncoprotein induced transcript 3
Synonyms: EF-9
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18302
Homologene: 7870
Itfg1
Name: integrin alpha FG-GAP repeat containing 1
Synonyms: 2310047C21Rik, D8Wsu49e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 71927
Homologene: 12423
Dmrt1
Name: doublesex and mab-3 related transcription factor 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 50796
HGNC: HGNC:2934
Homologene: 9280
Glt1d1
Name: glycosyltransferase 1 domain containing 1
Synonyms: 5730455A04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319804
Homologene: 16965
Baz2b
Name: bromodomain adjacent to zinc finger domain, 2B
Synonyms: D2Ertd794e, 5830435C13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 407823
HGNC: HGNC:963
Homologene: 8394
Tmem131l
Name: transmembrane 131 like
Synonyms: D930015E06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229473
Homologene: 9057
Dhx37
Name: DEAH-box helicase 37
Synonyms: LOC208144, LOC381671
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 208144
Homologene: 6641
Abca13
Name: ATP-binding cassette, sub-family A member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268379
Homologene: 27991
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545370
Homologene: 23741
Lrrc37a
Name: leucine rich repeat containing 37A
Synonyms: LOC237954
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237954
Homologene: 138824
Cntn3
Name: contactin 3
Synonyms: Pang
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18488
HGNC: HGNC:2173
Homologene: 7461
Nlrp9a
Name: NLR family, pyrin domain containing 9A
Synonyms: D7Ertd565e, Nalp9a, Nalp-theta
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233001
Homologene: 116072
Naip2
Name: NLR family, apoptosis inhibitory protein 2
Synonyms: Naip2, Naip-rs6, Birc1b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17948
HGNC: HGNC:7634
Homologene: 136092
Sntg1
Name: syntrophin, gamma 1
Synonyms: G1SYN, SYN4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71096
Homologene: 56834
Adcy3
Name: adenylate cyclase 3
Synonyms: AC3, ACIII
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104111
HGNC: HGNC:234
Homologene: 2978
Mrgprx2
Name: MAS-related GPR, member X2
Synonyms: MrgB10, Mrgprb10
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243978
Homologene: 24986
Fer1l4
Name: fer-1 like family member 4
Synonyms: 9130402C12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74562
Homologene: 19075
Atxn7
Name: ataxin 7
Synonyms: ataxin-7, Sca7, A430107N12Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 246103
VEGA: 14
Homologene: 30967
Jmjd8
Name: jumonji domain containing 8
Synonyms: 2610003J06Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72106
Homologene: 12441
Vmn2r111
Name: vomeronasal 2, receptor 111
Synonyms: EG210876
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 210876
Homologene: 86604
Myt1l
Name: myelin transcription factor 1-like
Synonyms: Png-1, Nztf1, Pmng1, C630034G21Rik, 2900093J19Rik, 2900046C06Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 17933
VEGA: 12
HGNC: HGNC:7623
Homologene: 7435
Or2aj6
Name: olfactory receptor family 2 subfamily AJ member 6
Synonyms: GA_x54KRFPKG5P-16071018-16070077, MOR273-1, MOR273-5, Olfr171
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258960
Homologene: 128058
Cacna1i
Name: calcium channel, voltage-dependent, alpha 1I subunit
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239556
HGNC: HGNC:1396
Homologene: 69331
Igsf10
Name: immunoglobulin superfamily, member 10
Synonyms: 6530405F15Rik, CMF608, Adlican2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242050
Homologene: 18712
Klhl32
Name: kelch-like 32
Synonyms: LOC384000, D4Ertd389e, 6430524H05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 212390
Homologene: 14173
Kcnma1
Name: potassium large conductance calcium-activated channel, subfamily M, alpha member 1
Synonyms: Slo, mSlo1, Slo1, MaxiK, BK channel alpha subunit, 5730414M22Rik, BKCa
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16531
HGNC: HGNC:6284
Homologene: 1693
Zfp623
Name: zinc finger protein 623
Synonyms: 2610029D06Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78834
VEGA: 15
Homologene: 15994
Col6a4
Name: collagen, type VI, alpha 4
Synonyms: EG235580, 1110001D15Rik, Dvwa, Vwa6
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68553
Homologene: 130754
Spata31h1
Name: SPATA31 subfamily H member 1
Synonyms: 4932415D10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 102635990
VEGA: 10
Homologene: 82476
Zfp454
Name: zinc finger protein 454
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237758
Homologene: 72226
Pla2g4a
Name: phospholipase A2, group IVA (cytosolic, calcium-dependent)
Synonyms: cPLA2, Type IV PLA2, cytosolic PLA2, cPLA2alpha, cytosolic phospholipase A2, Pla2g4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18783
HGNC: HGNC:9035
Homologene: 32059
Fyn
Name: Fyn proto-oncogene
Synonyms: Src Kinase p59
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14360
HGNC: HGNC:4037
Homologene: 48068
Mylk
Name: myosin, light polypeptide kinase
Synonyms: telokin, Mlck, MLCK210, MLCK108, 9530072E15Rik, A930019C19Rik, nmMlck
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 107589
HGNC: HGNC:7590
Homologene: 14202
Glp1r
Name: glucagon-like peptide 1 receptor
Synonyms: GLP-1R, GLP1Rc
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14652
VEGA: 17
HGNC: HGNC:4324
Homologene: 1558
Nsd3
Name: nuclear receptor binding SET domain protein 3
Synonyms: WHISTLE, Whsc1l1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234135
Homologene: 56960
P2ry6
Name: pyrimidinergic receptor P2Y, G-protein coupled, 6
Synonyms: 2010204J23Rik, P2Y6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233571
HGNC: HGNC:8543
Homologene: 14289
Itprid1
Name: ITPR interacting domain containing 1
Synonyms: D530004J12Rik, Ccdc129
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232016
Homologene: 52344
Fam89a
Name: family with sequence similarity 89, member A
Synonyms: 2310031A18Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 69627
Homologene: 18887
Ces4a
Name: carboxylesterase 4A
Synonyms: Ces8
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234677
Homologene: 71949
Apc2
Name: APC regulator of WNT signaling pathway 2
Synonyms: APCL
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 23805
Homologene: 4299
Ctnna2
Name: catenin alpha 2
Synonyms: alpha(N)-catenin, alpha N-catenin, Catna, chp, Catna2, catenin (cadherin associated protein), alpha 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12386
HGNC: HGNC:2510
Homologene: 68394
Zfp827
Name: zinc finger protein 827
Synonyms: 2810449M09Rik, D630040G17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 622675
Homologene: 45622
Vmn1r75
Name: vomeronasal 1 receptor 75
Synonyms: V1rg6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 171241
Homologene: 44234
Gtpbp2
Name: GTP binding protein 2
Synonyms: nmf205
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 56055
HGNC: HGNC:4670
Homologene: 10420
Bahd1
Name: bromo adjacent homology domain containing 1
Synonyms: LOC228536
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228536
Homologene: 8976
1700018B08Rik
Name: RIKEN cDNA 1700018B08 gene
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76405
Homologene: 81929
Rgs13
Name: regulator of G-protein signaling 13
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 246709
HGNC: HGNC:9995
Homologene: 14774
Mettl21e
Name: methyltransferase like 21E
Synonyms: LOC381340, 4832428D23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 403183
Homologene: 19006
Gm7995
Name: predicted gene 7995
Synonyms: Gm3586
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 666233
Homologene: 115686
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 1 at 8,583,284 bp
  • T to G, chromosome 1 at 44,210,265 bp
  • A to G, chromosome 1 at 63,557,454 bp
  • G to T, chromosome 1 at 144,140,838 bp
  • T to A, chromosome 1 at 149,851,335 bp
  • T to C, chromosome 1 at 150,583,278 bp
  • T to C, chromosome 2 at 52,720,942 bp
  • C to T, chromosome 2 at 59,901,729 bp
  • A to G, chromosome 2 at 76,872,867 bp
  • T to C, chromosome 2 at 118,917,138 bp
  • A to C, chromosome 2 at 156,047,914 bp
  • C to A, chromosome 3 at 22,203,977 bp
  • G to T, chromosome 3 at 59,329,571 bp
  • A to G, chromosome 3 at 83,913,280 bp
  • A to T, chromosome 4 at 24,711,578 bp
  • A to T, chromosome 4 at 156,167,362 bp
  • A to G, chromosome 5 at 125,419,132 bp
  • T to A, chromosome 5 at 127,644,296 bp
  • A to G, chromosome 6 at 55,976,420 bp
  • A to G, chromosome 6 at 77,143,909 bp
  • G to T, chromosome 6 at 91,478,777 bp
  • T to A, chromosome 6 at 91,486,880 bp
  • G to A, chromosome 6 at 102,278,340 bp
  • T to A, chromosome 7 at 11,881,076 bp
  • A to T, chromosome 7 at 18,179,919 bp
  • A to C, chromosome 7 at 26,550,886 bp
  • G to A, chromosome 7 at 39,534,162 bp
  • A to T, chromosome 7 at 48,482,869 bp
  • T to C, chromosome 7 at 100,938,373 bp
  • T to C, chromosome 8 at 25,714,185 bp
  • T to G, chromosome 8 at 33,319,220 bp
  • G to T, chromosome 8 at 70,572,903 bp
  • A to G, chromosome 8 at 79,189,977 bp
  • A to G, chromosome 8 at 85,740,301 bp
  • G to A, chromosome 8 at 105,149,458 bp
  • T to G, chromosome 8 at 121,540,554 bp
  • G to A, chromosome 8 at 124,741,243 bp
  • A to T, chromosome 9 at 88,844,950 bp
  • A to T, chromosome 9 at 106,074,992 bp
  • T to C, chromosome 10 at 39,551,402 bp
  • A to T, chromosome 10 at 59,438,552 bp
  • A to G, chromosome 10 at 80,313,923 bp
  • A to T, chromosome 10 at 82,289,304 bp
  • A to G, chromosome 10 at 119,986,424 bp
  • A to G, chromosome 11 at 9,298,661 bp
  • T to C, chromosome 11 at 50,874,123 bp
  • A to T, chromosome 11 at 76,077,055 bp
  • A to G, chromosome 11 at 103,456,660 bp
  • A to G, chromosome 12 at 4,212,150 bp
  • A to T, chromosome 12 at 29,832,366 bp
  • A to G, chromosome 12 at 105,804,937 bp
  • A to T, chromosome 13 at 100,160,685 bp
  • A to T, chromosome 14 at 14,089,446 bp
  • C to T, chromosome 14 at 23,336,097 bp
  • A to G, chromosome 14 at 42,311,370 bp
  • TGATGTCCGGGATGTCCGGGATGTCCGGGATGTCCGGGATGT to TGATGTCCGGGATGTCCGGGATGTCCGGGATGT, chromosome 14 at 75,323,558 bp
  • T to A, chromosome 15 at 75,948,459 bp
  • T to A, chromosome 15 at 80,378,247 bp
  • T to C, chromosome 15 at 89,304,908 bp
  • C to T, chromosome 16 at 19,624,444 bp
  • T to A, chromosome 16 at 34,929,867 bp
  • T to C, chromosome 17 at 22,559,051 bp
  • G to T, chromosome 17 at 24,477,961 bp
  • T to A, chromosome 17 at 25,829,112 bp
  • T to A, chromosome 17 at 26,142,994 bp
  • T to C, chromosome 17 at 30,924,572 bp
  • G to T, chromosome 17 at 46,168,221 bp
  • T to C, chromosome 17 at 73,525,370 bp
  • C to A, chromosome 18 at 34,629,490 bp
  • A to G, chromosome 19 at 25,410,085 bp
  • T to A, chromosome 19 at 25,546,031 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6490 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044622-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.