Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6490Btlr/Mmmh
Stock Number:
044622-MU
Citation ID:
RRID:MMRRC_044622-MU
Other Names:
R6490 (G1)
Major Collection:

Strain Information

Wrn
Name: Werner syndrome RecQ like helicase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22427
Homologene: 6659
Stam2
Name: signal transducing adaptor molecule (SH3 domain and ITAM motif) 2
Synonyms: Hbp, 1200004O12Rik, 5730456G07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56324
Homologene: 68490
Mlst8
Name: MTOR associated protein, LST8 homolog (S. cerevisiae)
Synonyms: 0610033N12Rik, mLST8, Gbl
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 56716
VEGA: 17
Homologene: 6833
Adam23
Name: a disintegrin and metallopeptidase domain 23
Synonyms: MDC3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23792
HGNC: HGNC:202
Homologene: 2826
Kif20a
Name: kinesin family member 20A
Synonyms: Rabkinesin-6, Rab6kifl
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 19348
VEGA: 18
HGNC: HGNC:9787
Homologene: 38093
Agrn
Name: agrin
Synonyms: NMF380, Agrin, nmf380
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11603
HGNC: HGNC:329
Homologene: 27907
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 1 at 8,583,284 bp
  • T to G, chromosome 1 at 44,210,265 bp
  • A to G, chromosome 1 at 63,557,454 bp
  • G to T, chromosome 1 at 144,140,838 bp
  • T to A, chromosome 1 at 149,851,335 bp
  • T to C, chromosome 1 at 150,583,278 bp
  • T to C, chromosome 2 at 52,720,942 bp
  • C to T, chromosome 2 at 59,901,729 bp
  • A to G, chromosome 2 at 76,872,867 bp
  • T to C, chromosome 2 at 118,917,138 bp
  • A to C, chromosome 2 at 156,047,914 bp
  • C to A, chromosome 3 at 22,203,977 bp
  • G to T, chromosome 3 at 59,329,571 bp
  • A to G, chromosome 3 at 83,913,280 bp
  • A to T, chromosome 4 at 24,711,578 bp
  • A to T, chromosome 4 at 156,167,362 bp
  • A to G, chromosome 5 at 125,419,132 bp
  • T to A, chromosome 5 at 127,644,296 bp
  • A to G, chromosome 6 at 55,976,420 bp
  • A to G, chromosome 6 at 77,143,909 bp
  • G to T, chromosome 6 at 91,478,777 bp
  • T to A, chromosome 6 at 91,486,880 bp
  • G to A, chromosome 6 at 102,278,340 bp
  • T to A, chromosome 7 at 11,881,076 bp
  • A to T, chromosome 7 at 18,179,919 bp
  • A to C, chromosome 7 at 26,550,886 bp
  • G to A, chromosome 7 at 39,534,162 bp
  • A to T, chromosome 7 at 48,482,869 bp
  • T to C, chromosome 7 at 100,938,373 bp
  • T to C, chromosome 8 at 25,714,185 bp
  • T to G, chromosome 8 at 33,319,220 bp
  • G to T, chromosome 8 at 70,572,903 bp
  • A to G, chromosome 8 at 79,189,977 bp
  • A to G, chromosome 8 at 85,740,301 bp
  • G to A, chromosome 8 at 105,149,458 bp
  • T to G, chromosome 8 at 121,540,554 bp
  • G to A, chromosome 8 at 124,741,243 bp
  • A to T, chromosome 9 at 88,844,950 bp
  • A to T, chromosome 9 at 106,074,992 bp
  • T to C, chromosome 10 at 39,551,402 bp
  • A to T, chromosome 10 at 59,438,552 bp
  • A to G, chromosome 10 at 80,313,923 bp
  • A to T, chromosome 10 at 82,289,304 bp
  • A to G, chromosome 10 at 119,986,424 bp
  • A to G, chromosome 11 at 9,298,661 bp
  • T to C, chromosome 11 at 50,874,123 bp
  • A to T, chromosome 11 at 76,077,055 bp
  • A to G, chromosome 11 at 103,456,660 bp
  • A to G, chromosome 12 at 4,212,150 bp
  • A to T, chromosome 12 at 29,832,366 bp
  • A to G, chromosome 12 at 105,804,937 bp
  • A to T, chromosome 13 at 100,160,685 bp
  • A to T, chromosome 14 at 14,089,446 bp
  • C to T, chromosome 14 at 23,336,097 bp
  • A to G, chromosome 14 at 42,311,370 bp
  • TGATGTCCGGGATGTCCGGGATGTCCGGGATGTCCGGGATGT to TGATGTCCGGGATGTCCGGGATGTCCGGGATGT, chromosome 14 at 75,323,558 bp
  • T to A, chromosome 15 at 75,948,459 bp
  • T to A, chromosome 15 at 80,378,247 bp
  • T to C, chromosome 15 at 89,304,908 bp
  • C to T, chromosome 16 at 19,624,444 bp
  • T to A, chromosome 16 at 34,929,867 bp
  • T to C, chromosome 17 at 22,559,051 bp
  • G to T, chromosome 17 at 24,477,961 bp
  • T to A, chromosome 17 at 25,829,112 bp
  • T to A, chromosome 17 at 26,142,994 bp
  • T to C, chromosome 17 at 30,924,572 bp
  • G to T, chromosome 17 at 46,168,221 bp
  • T to C, chromosome 17 at 73,525,370 bp
  • C to A, chromosome 18 at 34,629,490 bp
  • A to G, chromosome 19 at 25,410,085 bp
  • T to A, chromosome 19 at 25,546,031 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6490 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044622-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.