Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6525Btlr/Mmmh
Stock Number:
044651-MU
Citation ID:
RRID:MMRRC_044651-MU
Other Names:
R6525 (G1)
Major Collection:

Strain Information

Slc12a6
Name: solute carrier family 12, member 6
Synonyms: KCC3, gaxp
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 107723
Homologene: 21069
Col3a1
Name: collagen, type III, alpha 1
Synonyms: Col3a-1, Tsk-2, Tsk2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12825
HGNC: HGNC:2201
Homologene: 55433
Slc26a5
Name: solute carrier family 26, member 5
Synonyms: Pres, prestin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 80979
HGNC: HGNC:9359
Homologene: 69472
Bahcc1
Name: BAH domain and coiled-coil containing 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268515
Homologene: 129585
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Dop1b
Name: DOP1 leucine zipper like protein B
Synonyms: 0610038M01Rik, 2610510B01Rik, Dopey2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70028
VEGA: 16
HGNC: HGNC:1291
Homologene: 21068
Arid5b
Name: AT-rich interaction domain 5B
Synonyms: 5430435G07Rik, Desrt, Mrf2beta, Mrf2alpha, Mrf2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71371
VEGA: 10
Homologene: 45872
Nmral1
Name: NmrA-like family domain containing 1
Synonyms: 1110025F24Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67824
Homologene: 41388
Fam53a
Name: family with sequence similarity 53, member A
Synonyms: 5430419M09Rik, DNTNP, 2410018C17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74504
Homologene: 18660
Enpp2
Name: ectonucleotide pyrophosphatase/phosphodiesterase 2
Synonyms: Autotaxin, Npps2, PD-Ialpha, Pdnp2, ATX
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18606
HGNC: HGNC:3357
Homologene: 4526
Ppp6r3
Name: protein phosphatase 6, regulatory subunit 3
Synonyms: 9130026N02Rik, D19Bwg1430e, 4930528G08Rik, D19Ertd703e, Pp6r3, Pptcs3, Saps3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 52036
VEGA: 19
HGNC: HGNC:1173
Homologene: 115911
Ltn1
Name: listerin E3 ubiquitin protein ligase 1
Synonyms: 4930528H02Rik, Zfp294, Listerin, Rnf160
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78913
VEGA: 16
Homologene: 32272
Slx4ip
Name: SLX4 interacting protein
Synonyms: 2410004I22Rik, 2210009G21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74243
Homologene: 49913
Nol9
Name: nucleolar protein 9
Synonyms: 6030462G04Rik, 4632412I24Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74035
Homologene: 32589
Ndc1
Name: NDC1 transmembrane nucleoporin
Synonyms: 2810475A17Rik, Tmem48, sks
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72787
Homologene: 41224
Ddx6
Name: DEAD-box helicase 6
Synonyms: mRCK/P54, HLR2, E230023J21Rik, p54, rck, 1110001P04Rik, C430015D01Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 6
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13209
VEGA: 9
HGNC: HGNC:2747
Homologene: 3238
Tiam1
Name: T cell lymphoma invasion and metastasis 1
Synonyms: D16Ium10, D16Ium10e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 21844
Homologene: 2443
Ddx52
Name: DExD box helicase 52
Synonyms: 2700029C06Rik, ROK1, DEAD (Asp-Glu-Ala-Asp) box polypeptide 52
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78394
Homologene: 5093
Wwc1
Name: WW, C2 and coiled-coil domain containing 1
Synonyms: Kibra
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 211652
Homologene: 69180
Syn3
Name: synapsin III
Synonyms: Synapsin IIIa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 27204
Homologene: 68320
Stt3b
Name: STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae)
Synonyms: Simp, 1300006C19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68292
VEGA: 9
Homologene: 7387
Tasor2
Name: transcription activation suppressor family member 2
Synonyms: BC016423, Fam208b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105203
VEGA: 13
Homologene: 26435
Rcn1
Name: reticulocalbin 1
Synonyms: Rcn
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19672
HGNC: HGNC:9934
Homologene: 20637
Tjp1
Name: tight junction protein 1
Synonyms: ZO-1, ZO1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 21872
Homologene: 2445
Gna13
Name: guanine nucleotide binding protein, alpha 13
Synonyms: Galpha13
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14674
HGNC: HGNC:4381
Homologene: 55976
Azi2
Name: 5-azacytidine induced gene 2
Synonyms: AZ2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 27215
Homologene: 8443
Flcn
Name: folliculin
Synonyms: B430214A04Rik, BHD
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216805
Homologene: 14583
Pgap1
Name: post-GPI attachment to proteins 1
Synonyms: 5033403E17Rik, 9030223K07Rik, D230012E17Rik, PGAP1, oto
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241062
Homologene: 41605
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545370
Homologene: 23741
Fat2
Name: FAT atypical cadherin 2
Synonyms: LOC245827, mKIAA0811, Fath2, EMI2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245827
HGNC: HGNC:3596
Homologene: 1110
Abca4
Name: ATP-binding cassette, sub-family A member 4
Synonyms: Rim protein, RmP, Abc10, D430003I15Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11304
HGNC: HGNC:34
Homologene: 298
Gorasp1
Name: golgi reassembly stacking protein 1
Synonyms: 5430411C10Rik, GRASP65, GOLPH5, P65
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74498
VEGA: 9
Homologene: 49916
Or4k51
Name: olfactory receptor family 4 subfamily K member 51
Synonyms: GA_x6K02T2Q125-72805651-72806589, MOR248-5, Olfr1301
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258889
Homologene: 74057
Hc
Name: hemolytic complement
Synonyms: C5a, C5, He, Hfib2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 15139
HGNC: HGNC:1331
Homologene: 20412
Faap100
Name: Fanconi anemia core complex associated protein 100
Synonyms: 2310003H01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71885
Homologene: 69394
Adcy8
Name: adenylate cyclase 8
Synonyms: AC8
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11514
VEGA: 15
HGNC: HGNC:239
Homologene: 37443
Agbl3
Name: ATP/GTP binding protein-like 3
Synonyms: 2900053G10Rik, 6530406M24Rik, 4930431N21Rik, Ccp3, Ccp3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 76223
Homologene: 35330
Rab11fip1
Name: RAB11 family interacting protein 1 (class I)
Synonyms: 2010200K21Rik, 4833414G05Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 75767
Homologene: 11853
Impg2
Name: interphotoreceptor matrix proteoglycan 2
Synonyms: PG10.2, IPM200, Spacrcan
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224224
Homologene: 9439
Tns1
Name: tensin 1
Synonyms: 1200014E20Rik, E030018G17Rik, 1110018I21Rik, Tns, E030037J05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21961
Homologene: 11219
Tmprss15
Name: transmembrane protease, serine 15
Synonyms: enteropeptidase, enterokinase, A130097D21Rik, Prss7
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19146
HGNC: HGNC:9490
Homologene: 2075
Slc13a3
Name: solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3
Synonyms: SDCT2, NaDC3, NaDC-3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 114644
Homologene: 11266
Mansc4
Name: MANSC domain containing 4
Synonyms: Gm5887
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 545893
Homologene: 86837
Lrrc49
Name: leucine rich repeat containing 49
Synonyms: D430025H09Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102747
Homologene: 9782
Hsdl2
Name: hydroxysteroid dehydrogenase like 2
Synonyms: 2610207I16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72479
Cnga1
Name: cyclic nucleotide gated channel alpha 1
Synonyms: Cncg
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12788
HGNC: HGNC:2148
Homologene: 55432
Dynlt1a
Name: dynein light chain Tctex-type 1A
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100310872
VEGA: 17
Homologene: 4754
Gm14226
Name: predicted gene 14226
Type: Gene
Species: Mouse
Chromosome: 2
Parp14
Name: poly (ADP-ribose) polymerase family, member 14
Synonyms: 1600029O10Rik, collaborator of Stat6, CoaSt6
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 547253
Homologene: 19697
Skint8
Name: selection and upkeep of intraepithelial T cells 8
Synonyms: OTTMUSG00000009475
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 639774
Homologene: 106613
Nacad
Name: NAC alpha domain containing
Synonyms: mKIAA0363
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192950
Homologene: 135717
Kbtbd12
Name: kelch repeat and BTB (POZ) domain containing 12
Synonyms: 4833415F11Rik, 4933428M03Rik, Klhdc6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74589
Homologene: 52613
Ldhb
Name: lactate dehydrogenase B
Synonyms: lactate dehydrogenase-B, Ldh-2, H-Ldh
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16832
HGNC: HGNC:6541
Homologene: 55647
Gbp10
Name: guanylate-binding protein 10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 626578
Homologene: 128731
Prb1a
Name: proline-rich protein BstNI subfamily 1A
Synonyms: proline-rich proteoglycan 2, Prb1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 381833
Kcnj12
Name: potassium inwardly-rectifying channel, subfamily J, member 12
Synonyms: Kir2.2, IRK2, MB-IRK2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16515
Homologene: 7793
Zfp119b
Name: zinc finger protein 119b
Synonyms: BC031441
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240120
Vmn2r81
Name: vomeronasal 2, receptor 81
Synonyms: pheromone recepter, EC1-VR2, V2rf2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216144
Homologene: 83483
Zbtb34
Name: zinc finger and BTB domain containing 34
Synonyms: LOC241311
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241311
Homologene: 19382
Krt1
Name: keratin 1
Synonyms: Krt2-1, Krt-2.1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16678
VEGA: 15
HGNC: HGNC:6412
Homologene: 38146
Oscp1
Name: organic solute carrier partner 1
Synonyms: 6030436A01Rik, 1810007P19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230751
Homologene: 71010
Antxrl
Name: anthrax toxin receptor-like
Synonyms: 1700112N15Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239029
VEGA: 14
Homologene: 52111
Rimkla
Name: ribosomal modification protein rimK-like family member A
Synonyms: Rimk, NAAGS-II
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 194237
Homologene: 18336
Hs3st3b1
Name: heparan sulfate (glucosamine) 3-O-sulfotransferase 3B1
Synonyms: 3OST3B1, HS3ST3B1, 3-OST-3B, m3-OST-3B, 3Ost3b
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 54710
HGNC: HGNC:5198
Homologene: 88576
Meltf
Name: melanotransferrin
Synonyms: MTf, CD228, melanotransferrin, Mfi2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 30060
VEGA: 16
HGNC: HGNC:7037
Homologene: 4335
Dusp7
Name: dual specificity phosphatase 7
Synonyms: PYST2, MKP-X
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235584
HGNC: HGNC:3073
Homologene: 1468
Acss2
Name: acyl-CoA synthetase short-chain family member 2
Synonyms: acetyl-CoA synthetase 1, ACAS, AceCS1, Acas1, Acs1, Acas2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 60525
Homologene: 6469
Prr16
Name: proline rich 16
Synonyms: 5430406M13Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 71373
VEGA: 18
Homologene: 41152
Nsun5
Name: NOL1/NOP2/Sun domain family, member 5
Synonyms: Nol1r, 9830109N13Rik, Wbscr20a
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100609
Homologene: 6828
Pced1b
Name: PC-esterase domain containing 1B
Synonyms: Fam113b
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239647
VEGA: 15
Homologene: 16301
Ugdh
Name: UDP-glucose dehydrogenase
Synonyms: Udpgdh
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22235
Homologene: 2520
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 34,163,135 bp
  • A to G, chromosome 1 at 45,347,179 bp
  • T to C, chromosome 1 at 54,481,889 bp
  • C to T, chromosome 1 at 73,953,470 bp
  • T to C, chromosome 1 at 150,697,566 bp
  • A to G, chromosome 2 at 33,412,133 bp
  • T to C, chromosome 2 at 34,991,224 bp
  • A to G, chromosome 2 at 76,943,092 bp
  • A to G, chromosome 2 at 105,388,975 bp
  • C to T, chromosome 2 at 111,754,984 bp
  • A to G, chromosome 2 at 112,352,451 bp
  • T to C, chromosome 2 at 137,000,218 bp
  • T to C, chromosome 2 at 155,025,083 bp
  • A to G, chromosome 2 at 155,550,417 bp
  • T to C, chromosome 2 at 165,406,747 bp
  • A to G, chromosome 3 at 122,137,659 bp
  • A to G, chromosome 4 at 59,612,696 bp
  • G to T, chromosome 4 at 107,368,107 bp
  • A to T, chromosome 4 at 111,928,738 bp
  • C to A, chromosome 4 at 119,468,091 bp
  • A to G, chromosome 4 at 126,076,778 bp
  • G to T, chromosome 4 at 152,039,449 bp
  • T to C, chromosome 5 at 21,820,350 bp
  • T to C, chromosome 5 at 33,607,918 bp
  • G to T, chromosome 5 at 65,417,059 bp
  • T to A, chromosome 5 at 72,618,231 bp
  • T to A, chromosome 5 at 105,236,084 bp
  • A to G, chromosome 5 at 135,375,058 bp
  • A to T, chromosome 6 at 34,803,594 bp
  • A to T, chromosome 6 at 88,614,080 bp
  • A to G, chromosome 6 at 132,207,504 bp
  • T to C, chromosome 6 at 142,490,465 bp
  • A to G, chromosome 6 at 147,075,147 bp
  • T to C, chromosome 7 at 65,343,651 bp
  • T to C, chromosome 8 at 27,156,499 bp
  • T to C, chromosome 9 at 44,623,629 bp
  • A to G, chromosome 9 at 60,598,149 bp
  • A to G, chromosome 9 at 106,369,284 bp
  • A to G, chromosome 9 at 115,258,558 bp
  • T to A, chromosome 9 at 118,047,595 bp
  • G to T, chromosome 9 at 119,927,995 bp
  • A to G, chromosome 10 at 68,097,666 bp
  • T to A, chromosome 10 at 79,293,726 bp
  • G to A, chromosome 10 at 86,467,052 bp
  • A to G, chromosome 11 at 6,602,255 bp
  • C to T, chromosome 11 at 35,853,437 bp
  • T to C, chromosome 11 at 55,283,800 bp
  • A to T, chromosome 11 at 59,794,172 bp
  • T to G, chromosome 11 at 61,069,571 bp
  • G to A, chromosome 11 at 63,921,598 bp
  • T to C, chromosome 11 at 83,953,319 bp
  • T to C, chromosome 11 at 109,395,939 bp
  • T to C, chromosome 11 at 120,285,222 bp
  • C to A, chromosome 11 at 120,378,764 bp
  • G to A, chromosome 13 at 3,576,540 bp
  • A to T, chromosome 14 at 34,060,406 bp
  • T to C, chromosome 15 at 54,870,211 bp
  • C to A, chromosome 15 at 64,737,394 bp
  • T to A, chromosome 15 at 97,384,798 bp
  • AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC to AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC, chromosome 15 at 101,850,378 bp
  • T to A, chromosome 16 at 4,714,432 bp
  • G to A, chromosome 16 at 31,888,899 bp
  • C to T, chromosome 16 at 35,860,441 bp
  • A to G, chromosome 16 at 56,205,149 bp
  • T to A, chromosome 16 at 79,003,378 bp
  • A to G, chromosome 16 at 87,420,186 bp
  • A to T, chromosome 16 at 89,858,597 bp
  • T to A, chromosome 16 at 93,809,416 bp
  • T to A, chromosome 17 at 6,311,739 bp
  • A to G, chromosome 17 at 55,939,992 bp
  • C to A, chromosome 18 at 3,268,070 bp
  • T to G, chromosome 18 at 51,303,155 bp
  • T to A, chromosome 19 at 3,493,936 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6525 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044651-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.