Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6525Btlr/Mmmh
Stock Number:
044651-MU
Citation ID:
RRID:MMRRC_044651-MU
Other Names:
R6525 (G1)
Major Collection:

Strain Information

Slc12a6
Name: solute carrier family 12, member 6
Synonyms: KCC3, gaxp
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 107723
Homologene: 21069
Col3a1
Name: collagen, type III, alpha 1
Synonyms: Col3a-1, Tsk-2, Tsk2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12825
HGNC: HGNC:2201
Homologene: 55433
Slc26a5
Name: solute carrier family 26, member 5
Synonyms: Pres, prestin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 80979
HGNC: HGNC:9359
Homologene: 69472
Bahcc1
Name: BAH domain and coiled-coil containing 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268515
Homologene: 129585
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Dop1b
Name: DOP1 leucine zipper like protein B
Synonyms: 0610038M01Rik, 2610510B01Rik, Dopey2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70028
VEGA: 16
HGNC: HGNC:1291
Homologene: 21068
Arid5b
Name: AT-rich interaction domain 5B
Synonyms: 5430435G07Rik, Desrt, Mrf2beta, Mrf2alpha, Mrf2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71371
VEGA: 10
Homologene: 45872
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 34,163,135 bp
  • A to G, chromosome 1 at 45,347,179 bp
  • T to C, chromosome 1 at 54,481,889 bp
  • C to T, chromosome 1 at 73,953,470 bp
  • T to C, chromosome 1 at 150,697,566 bp
  • A to G, chromosome 2 at 33,412,133 bp
  • T to C, chromosome 2 at 34,991,224 bp
  • A to G, chromosome 2 at 76,943,092 bp
  • A to G, chromosome 2 at 105,388,975 bp
  • C to T, chromosome 2 at 111,754,984 bp
  • A to G, chromosome 2 at 112,352,451 bp
  • T to C, chromosome 2 at 137,000,218 bp
  • T to C, chromosome 2 at 155,025,083 bp
  • A to G, chromosome 2 at 155,550,417 bp
  • T to C, chromosome 2 at 165,406,747 bp
  • A to G, chromosome 3 at 122,137,659 bp
  • A to G, chromosome 4 at 59,612,696 bp
  • G to T, chromosome 4 at 107,368,107 bp
  • A to T, chromosome 4 at 111,928,738 bp
  • C to A, chromosome 4 at 119,468,091 bp
  • A to G, chromosome 4 at 126,076,778 bp
  • G to T, chromosome 4 at 152,039,449 bp
  • T to C, chromosome 5 at 21,820,350 bp
  • T to C, chromosome 5 at 33,607,918 bp
  • G to T, chromosome 5 at 65,417,059 bp
  • T to A, chromosome 5 at 72,618,231 bp
  • T to A, chromosome 5 at 105,236,084 bp
  • A to G, chromosome 5 at 135,375,058 bp
  • A to T, chromosome 6 at 34,803,594 bp
  • A to T, chromosome 6 at 88,614,080 bp
  • A to G, chromosome 6 at 132,207,504 bp
  • T to C, chromosome 6 at 142,490,465 bp
  • A to G, chromosome 6 at 147,075,147 bp
  • T to C, chromosome 7 at 65,343,651 bp
  • T to C, chromosome 8 at 27,156,499 bp
  • T to C, chromosome 9 at 44,623,629 bp
  • A to G, chromosome 9 at 60,598,149 bp
  • A to G, chromosome 9 at 106,369,284 bp
  • A to G, chromosome 9 at 115,258,558 bp
  • T to A, chromosome 9 at 118,047,595 bp
  • G to T, chromosome 9 at 119,927,995 bp
  • A to G, chromosome 10 at 68,097,666 bp
  • T to A, chromosome 10 at 79,293,726 bp
  • G to A, chromosome 10 at 86,467,052 bp
  • A to G, chromosome 11 at 6,602,255 bp
  • C to T, chromosome 11 at 35,853,437 bp
  • T to C, chromosome 11 at 55,283,800 bp
  • A to T, chromosome 11 at 59,794,172 bp
  • T to G, chromosome 11 at 61,069,571 bp
  • G to A, chromosome 11 at 63,921,598 bp
  • T to C, chromosome 11 at 83,953,319 bp
  • T to C, chromosome 11 at 109,395,939 bp
  • T to C, chromosome 11 at 120,285,222 bp
  • C to A, chromosome 11 at 120,378,764 bp
  • G to A, chromosome 13 at 3,576,540 bp
  • A to T, chromosome 14 at 34,060,406 bp
  • T to C, chromosome 15 at 54,870,211 bp
  • C to A, chromosome 15 at 64,737,394 bp
  • T to A, chromosome 15 at 97,384,798 bp
  • AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC to AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC, chromosome 15 at 101,850,378 bp
  • T to A, chromosome 16 at 4,714,432 bp
  • G to A, chromosome 16 at 31,888,899 bp
  • C to T, chromosome 16 at 35,860,441 bp
  • A to G, chromosome 16 at 56,205,149 bp
  • T to A, chromosome 16 at 79,003,378 bp
  • A to G, chromosome 16 at 87,420,186 bp
  • A to T, chromosome 16 at 89,858,597 bp
  • T to A, chromosome 16 at 93,809,416 bp
  • T to A, chromosome 17 at 6,311,739 bp
  • A to G, chromosome 17 at 55,939,992 bp
  • C to A, chromosome 18 at 3,268,070 bp
  • T to G, chromosome 18 at 51,303,155 bp
  • T to A, chromosome 19 at 3,493,936 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6525 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044651-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.