Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6818Btlr/Mmmh
Stock Number:
044930-MU
Citation ID:
RRID:MMRRC_044930-MU
Other Names:
R6818 (G1)
Major Collection:

Strain Information

Nsfl1c
Name: NSFL1 (p97) cofactor (p47)
Synonyms: p47
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 386649
Homologene: 41114
Faf2
Name: Fas associated factor family member 2
Synonyms: 2210404D11Rik, Ubxd8
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76577
Homologene: 8753
Cltc
Name: clathrin heavy chain
Synonyms: CHC
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67300
HGNC: HGNC:2092
Homologene: 3572
Dip2b
Name: disco interacting protein 2 homolog B
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239667
Homologene: 72227
Dvl2
Name: dishevelled segment polarity protein 2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13543
HGNC: HGNC:3086
Homologene: 20927
Hif1a
Name: hypoxia inducible factor 1, alpha subunit
Synonyms: MOP1, HIF-1alpha, HIF1alpha, bHLHe78
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 15251
HGNC: HGNC:4910
Homologene: 1171
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 59,630,169 bp
  • A to T, chromosome 1 at 80,615,365 bp
  • C to CTCTA, chromosome 2 at 25,579,721 bp
  • T to A, chromosome 2 at 32,630,373 bp
  • C to A, chromosome 2 at 65,688,669 bp
  • T to A, chromosome 2 at 82,985,200 bp
  • T to G, chromosome 2 at 111,335,314 bp
  • T to A, chromosome 2 at 151,503,020 bp
  • C to T, chromosome 2 at 153,686,284 bp
  • T to C, chromosome 2 at 157,107,497 bp
  • T to C, chromosome 2 at 164,563,150 bp
  • T to C, chromosome 3 at 35,814,180 bp
  • A to C, chromosome 3 at 53,845,253 bp
  • A to G, chromosome 3 at 93,443,411 bp
  • T to C, chromosome 4 at 9,282,014 bp
  • G to T, chromosome 4 at 63,154,006 bp
  • T to A, chromosome 4 at 99,963,566 bp
  • G to T, chromosome 5 at 31,265,960 bp
  • A to G, chromosome 5 at 34,782,767 bp
  • T to A, chromosome 6 at 30,746,287 bp
  • A to C, chromosome 6 at 92,905,191 bp
  • T to C, chromosome 7 at 6,514,551 bp
  • T to C, chromosome 7 at 11,613,059 bp
  • C to T, chromosome 7 at 16,273,161 bp
  • A to T, chromosome 7 at 44,229,459 bp
  • A to G, chromosome 7 at 131,316,665 bp
  • T to G, chromosome 7 at 133,717,759 bp
  • C to T, chromosome 8 at 16,185,327 bp
  • G to T, chromosome 8 at 47,822,722 bp
  • G to T, chromosome 9 at 26,751,702 bp
  • T to A, chromosome 9 at 82,025,521 bp
  • A to G, chromosome 9 at 110,088,031 bp
  • A to G, chromosome 10 at 4,541,782 bp
  • A to T, chromosome 10 at 130,386,278 bp
  • T to C, chromosome 11 at 5,195,051 bp
  • T to A, chromosome 11 at 54,979,500 bp
  • T to A, chromosome 11 at 55,309,341 bp
  • T to A, chromosome 11 at 58,757,957 bp
  • T to A, chromosome 11 at 66,925,893 bp
  • T to C, chromosome 11 at 70,009,273 bp
  • A to G, chromosome 11 at 86,704,228 bp
  • A to T, chromosome 12 at 73,945,563 bp
  • A to C, chromosome 12 at 84,042,009 bp
  • T to A, chromosome 12 at 118,901,354 bp
  • C to A, chromosome 13 at 27,714,471 bp
  • A to T, chromosome 13 at 33,832,354 bp
  • T to A, chromosome 13 at 54,641,606 bp
  • A to G, chromosome 13 at 67,833,867 bp
  • A to G, chromosome 14 at 75,963,308 bp
  • A to G, chromosome 14 at 111,680,294 bp
  • A to G, chromosome 14 at 113,315,016 bp
  • T to C, chromosome 15 at 100,193,954 bp
  • A to G, chromosome 16 at 26,477,507 bp
  • A to T, chromosome 16 at 30,543,221 bp
  • A to T, chromosome 17 at 18,947,931 bp
  • A to G, chromosome 17 at 36,670,435 bp
  • T to A, chromosome 17 at 37,752,424 bp
  • A to G, chromosome 17 at 48,302,897 bp
  • T to A, chromosome 19 at 8,873,881 bp
  • T to C, chromosome 19 at 25,169,501 bp
  • GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC to GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC, chromosome X at 8,086,211 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6818 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044930-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.