Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6941Btlr/Mmmh
Stock Number:
045055-MU
Citation ID:
RRID:MMRRC_045055-MU
Other Names:
R6941 (G1)
Major Collection:

Strain Information

Slc12a1
Name: solute carrier family 12, member 1
Synonyms: Nkcc2, mBSC1, D630042G03Rik, urehr3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20495
Homologene: 286
Atg7
Name: autophagy related 7
Synonyms: 1810013K23Rik, Apg7l
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74244
Homologene: 4662
Mtmr3
Name: myotubularin related protein 3
Synonyms: FYVE-DSP1, 1700092A20Rik, ZFYVE10
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74302
HGNC: HGNC:7451
Homologene: 23662
Slc6a1
Name: solute carrier family 6 (neurotransmitter transporter, GABA), member 1
Synonyms: XT-1, Gabt, Xtrp1, Gat1, Gabt1, GAT-1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232333
Homologene: 2290
Ppp1r16b
Name: protein phosphatase 1, regulatory subunit 16B
Synonyms: ANKRD4, Wdt4, C130078N17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228852
Homologene: 9194
Wwp2
Name: WW domain containing E3 ubiquitin protein ligase 2
Synonyms: 1300010O06Rik, AIP2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66894
Homologene: 48490
Birc2
Name: baculoviral IAP repeat-containing 2
Synonyms: mcIAP1, MIAP1, IAP1, MIHB, Api1, cIAP1, cIAP-1, HIAP1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11797
HGNC: HGNC:590
Homologene: 900
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 21,405,844 bp
  • G to A, chromosome 1 at 83,408,090 bp
  • G to T, chromosome 1 at 130,847,327 bp
  • T to C, chromosome 1 at 138,502,638 bp
  • A to G, chromosome 2 at 102,450,558 bp
  • G to T, chromosome 2 at 125,214,079 bp
  • A to T, chromosome 2 at 158,696,148 bp
  • A to G, chromosome 2 at 167,015,377 bp
  • T to C, chromosome 3 at 30,624,820 bp
  • T to C, chromosome 3 at 108,079,293 bp
  • T to G, chromosome 3 at 125,609,511 bp
  • A to G, chromosome 4 at 74,098,126 bp
  • T to C, chromosome 4 at 129,082,779 bp
  • A to T, chromosome 5 at 115,172,901 bp
  • A to T, chromosome 5 at 121,649,357 bp
  • G to A, chromosome 6 at 65,447,401 bp
  • A to G, chromosome 6 at 82,403,865 bp
  • G to A, chromosome 6 at 114,313,512 bp
  • C to T, chromosome 6 at 114,673,678 bp
  • A to G, chromosome 7 at 3,159,427 bp
  • C to A, chromosome 7 at 43,952,789 bp
  • G to A, chromosome 7 at 105,901,980 bp
  • A to T, chromosome 7 at 120,541,147 bp
  • A to G, chromosome 7 at 127,542,597 bp
  • G to A, chromosome 8 at 27,156,275 bp
  • T to C, chromosome 8 at 48,674,416 bp
  • G to A, chromosome 8 at 55,940,926 bp
  • A to G, chromosome 8 at 70,630,144 bp
  • T to A, chromosome 8 at 107,548,502 bp
  • A to G, chromosome 9 at 7,819,468 bp
  • A to G, chromosome 9 at 62,272,870 bp
  • A to G, chromosome 10 at 7,126,758 bp
  • A to G, chromosome 10 at 11,391,085 bp
  • A to G, chromosome 10 at 18,625,455 bp
  • T to C, chromosome 10 at 62,430,586 bp
  • G to A, chromosome 10 at 71,348,090 bp
  • T to C, chromosome 11 at 4,487,505 bp
  • A to G, chromosome 11 at 20,304,346 bp
  • T to C, chromosome 11 at 55,262,088 bp
  • A to T, chromosome 11 at 73,690,333 bp
  • CCAGCAGCAGCAGCAGCAGCAG to CCAGCAGCAGCAGCAGCAG, chromosome 11 at 77,686,296 bp
  • A to G, chromosome 11 at 82,889,797 bp
  • T to C, chromosome 12 at 4,629,641 bp
  • A to T, chromosome 12 at 114,583,828 bp
  • A to T, chromosome 13 at 102,706,191 bp
  • A to T, chromosome 13 at 102,804,714 bp
  • T to G, chromosome 14 at 20,562,109 bp
  • G to C, chromosome 14 at 37,060,095 bp
  • C to A, chromosome 15 at 78,446,777 bp
  • TAGTAAGAGT to TAGT, chromosome 16 at 70,433,556 bp
  • T to C, chromosome 17 at 32,416,074 bp
  • T to C, chromosome 18 at 20,097,189 bp
  • C to T, chromosome 18 at 20,267,923 bp
  • G to T, chromosome 18 at 34,416,883 bp
  • G to A, chromosome 18 at 37,958,288 bp
  • T to A, chromosome 19 at 12,999,497 bp
  • A to T, chromosome 19 at 15,920,943 bp
  • A to T, chromosome 19 at 34,252,522 bp
  • T to C, chromosome Y at 2,121,491 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6941 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045055-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.