Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7174Btlr/Mmmh
Stock Number:
045266-MU
Citation ID:
RRID:MMRRC_045266-MU
Other Names:
R7174 (G1)
Major Collection:

Strain Information

Slc26a5
Name: solute carrier family 26, member 5
Synonyms: Pres, prestin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 80979
HGNC: HGNC:9359
Homologene: 69472
Cd86
Name: CD86 antigen
Synonyms: B7-2, MB7-2, B70, Ly-58, Cd28l2, B7.2, Ly58
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12524
HGNC: HGNC:1705
Homologene: 10443
Cr1l
Name: complement C3b/C4b receptor 1 like
Synonyms: mCRY, Crry
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12946
Homologene: 128275
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Socs3
Name: suppressor of cytokine signaling 3
Synonyms: EF-10, SOCS-3, cytokine-inducible SH2 protein 3, CIS3, STAT-induced STAT inhibitor 3, SSI-3, E2a-Pbx1 target gene in fibroblasts 10, Cish3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12702
Homologene: 2941
Wnk1
Name: WNK lysine deficient protein kinase 1
Synonyms: 6430573H23Rik, Prkwnk1, EG406236, Hsn2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232341
Homologene: 14253
Katnb1
Name: katanin p80 (WD40-containing) subunit B 1
Synonyms: KAT, 2410003J24Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74187
HGNC: HGNC:6217
Homologene: 4302
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 96,837,598 bp
  • A to T, chromosome 1 at 136,521,257 bp
  • C to T, chromosome 1 at 195,129,189 bp
  • T to C, chromosome 2 at 69,433,072 bp
  • C to T, chromosome 2 at 85,721,953 bp
  • A to G, chromosome 2 at 125,896,701 bp
  • A to T, chromosome 2 at 164,902,503 bp
  • C to T, chromosome 3 at 93,446,171 bp
  • T to C, chromosome 4 at 12,077,337 bp
  • C to T, chromosome 4 at 43,770,691 bp
  • G to T, chromosome 4 at 82,922,256 bp
  • A to G, chromosome 4 at 101,750,338 bp
  • T to G, chromosome 4 at 106,362,681 bp
  • A to G, chromosome 4 at 107,037,646 bp
  • A to G, chromosome 4 at 118,589,067 bp
  • T to A, chromosome 4 at 134,055,753 bp
  • T to C, chromosome 5 at 10,245,270 bp
  • A to G, chromosome 5 at 21,813,894 bp
  • C to G, chromosome 5 at 62,604,278 bp
  • T to A, chromosome 5 at 96,755,577 bp
  • C to A, chromosome 5 at 145,044,817 bp
  • C to T, chromosome 5 at 145,097,277 bp
  • A to C, chromosome 6 at 57,389,624 bp
  • A to G, chromosome 6 at 70,117,598 bp
  • A to G, chromosome 6 at 102,165,344 bp
  • A to C, chromosome 6 at 119,970,978 bp
  • A to T, chromosome 6 at 130,335,978 bp
  • A to T, chromosome 7 at 12,581,701 bp
  • T to A, chromosome 7 at 17,757,914 bp
  • A to G, chromosome 7 at 19,765,451 bp
  • T to C, chromosome 7 at 26,385,297 bp
  • T to C, chromosome 7 at 79,377,342 bp
  • T to C, chromosome 7 at 100,432,198 bp
  • C to T, chromosome 7 at 101,346,019 bp
  • A to T, chromosome 7 at 103,561,391 bp
  • T to A, chromosome 7 at 108,423,160 bp
  • T to C, chromosome 7 at 140,467,163 bp
  • C to T, chromosome 8 at 27,453,277 bp
  • G to A, chromosome 8 at 95,097,441 bp
  • G to T, chromosome 10 at 76,225,339 bp
  • T to C, chromosome 10 at 103,224,965 bp
  • T to A, chromosome 10 at 111,300,767 bp
  • C to A, chromosome 11 at 99,024,096 bp
  • TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC to TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC, chromosome 11 at 100,189,077 bp
  • A to T, chromosome 11 at 117,967,727 bp
  • T to A, chromosome 12 at 98,974,701 bp
  • T to C, chromosome 13 at 11,801,177 bp
  • A to T, chromosome 13 at 59,728,580 bp
  • A to T, chromosome 13 at 118,715,406 bp
  • T to C, chromosome 14 at 50,186,696 bp
  • TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG to TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG, chromosome 15 at 5,098,691 bp
  • T to C, chromosome 15 at 55,048,739 bp
  • A to T, chromosome 15 at 99,424,003 bp
  • T to A, chromosome 16 at 14,136,953 bp
  • A to G, chromosome 16 at 21,926,256 bp
  • CA to CAA, chromosome 16 at 36,606,555 bp
  • C to A, chromosome 16 at 85,799,172 bp
  • T to C, chromosome 17 at 33,934,990 bp
  • A to T, chromosome 17 at 55,991,356 bp
  • A to T, chromosome 17 at 56,017,846 bp
  • A to T, chromosome 18 at 37,643,000 bp
  • A to G, chromosome 18 at 37,675,927 bp
  • T to C, chromosome 18 at 61,066,515 bp
  • T to C, chromosome 18 at 63,671,596 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7174 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045266-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.