Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7231Btlr/Mmmh
Stock Number:
045342-MU
Citation ID:
RRID:MMRRC_045342-MU
Other Names:
R7231 (G1)
Major Collection:

Strain Information

Plekhj1
Name: pleckstrin homology domain containing, family J member 1
Synonyms: 9530063M10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 78670
VEGA: 10
Homologene: 11389
Dtx4
Name: deltex 4, E3 ubiquitin ligase
Synonyms: RNF155
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 207521
VEGA: 19
Homologene: 27781
Ptpn3
Name: protein tyrosine phosphatase, non-receptor type 3
Synonyms: PTPCL, 9530011I20Rik, PTP-H1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 545622
HGNC: HGNC:9655
Homologene: 74451
Suclg1
Name: succinate-CoA ligase, GDP-forming, alpha subunit
Synonyms: Sucla1, 1500000I01Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56451
Homologene: 55785
Ppp2r5d
Name: protein phosphatase 2, regulatory subunit B', delta
Synonyms: TEG-271, Tex271, B'delta
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21770
VEGA: 17
HGNC: HGNC:9312
Homologene: 37661
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 150,638,876 bp
  • CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC to CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC, chromosome 1 at 174,609,203 bp
  • A to G, chromosome 1 at 188,759,763 bp
  • T to A, chromosome 2 at 11,290,451 bp
  • T to A, chromosome 2 at 71,532,496 bp
  • A to T, chromosome 2 at 112,042,366 bp
  • T to C, chromosome 2 at 164,786,201 bp
  • C to A, chromosome 3 at 90,251,790 bp
  • T to A, chromosome 3 at 94,773,192 bp
  • G to A, chromosome 3 at 108,800,809 bp
  • T to A, chromosome 4 at 57,245,062 bp
  • T to C, chromosome 4 at 115,609,697 bp
  • A to G, chromosome 4 at 145,057,462 bp
  • T to C, chromosome 4 at 155,862,826 bp
  • C to A, chromosome 5 at 32,901,865 bp
  • C to T, chromosome 5 at 33,898,825 bp
  • A to T, chromosome 5 at 124,813,828 bp
  • G to T, chromosome 6 at 23,654,891 bp
  • A to G, chromosome 6 at 29,944,487 bp
  • A to T, chromosome 6 at 47,800,957 bp
  • G to A, chromosome 6 at 73,263,971 bp
  • G to A, chromosome 6 at 113,765,732 bp
  • C to T, chromosome 6 at 149,044,604 bp
  • C to T, chromosome 7 at 9,097,638 bp
  • A to T, chromosome 7 at 10,053,083 bp
  • A to T, chromosome 7 at 11,846,961 bp
  • G to A, chromosome 7 at 25,748,417 bp
  • A to G, chromosome 7 at 35,628,446 bp
  • A to G, chromosome 7 at 101,505,953 bp
  • T to C, chromosome 7 at 105,085,787 bp
  • A to T, chromosome 7 at 106,818,443 bp
  • A to G, chromosome 7 at 141,360,392 bp
  • T to C, chromosome 8 at 43,136,371 bp
  • G to A, chromosome 8 at 71,253,137 bp
  • T to A, chromosome 8 at 94,521,805 bp
  • C to T, chromosome 8 at 105,272,147 bp
  • T to C, chromosome 8 at 105,461,057 bp
  • T to C, chromosome 8 at 110,222,546 bp
  • T to A, chromosome 9 at 19,941,559 bp
  • C to A, chromosome 9 at 30,906,158 bp
  • T to C, chromosome 9 at 32,424,188 bp
  • T to C, chromosome 9 at 66,752,317 bp
  • C to T, chromosome 9 at 71,632,645 bp
  • C to A, chromosome 9 at 103,225,148 bp
  • T to A, chromosome 10 at 26,339,282 bp
  • T to G, chromosome 10 at 80,797,658 bp
  • T to A, chromosome 10 at 80,835,104 bp
  • A to T, chromosome 11 at 9,294,175 bp
  • T to C, chromosome 11 at 46,224,136 bp
  • T to C, chromosome 11 at 65,965,647 bp
  • T to C, chromosome 11 at 109,721,375 bp
  • T to A, chromosome 12 at 31,547,946 bp
  • A to G, chromosome 12 at 55,604,191 bp
  • A to G, chromosome 12 at 56,337,762 bp
  • T to A, chromosome 12 at 87,201,044 bp
  • A to G, chromosome 12 at 113,288,016 bp
  • A to G, chromosome 13 at 116,303,290 bp
  • A to T, chromosome 14 at 30,896,614 bp
  • A to T, chromosome 14 at 53,977,568 bp
  • C to T, chromosome 15 at 75,840,382 bp
  • T to C, chromosome 15 at 85,206,152 bp
  • C to A, chromosome 15 at 85,816,188 bp
  • T to G, chromosome 15 at 89,458,076 bp
  • T to A, chromosome 15 at 101,136,223 bp
  • A to G, chromosome 16 at 20,604,128 bp
  • T to C, chromosome 17 at 6,236,235 bp
  • T to C, chromosome 17 at 6,297,920 bp
  • C to T, chromosome 17 at 24,650,104 bp
  • G to A, chromosome 17 at 30,986,116 bp
  • G to A, chromosome 17 at 44,814,192 bp
  • A to T, chromosome 17 at 46,684,060 bp
  • T to A, chromosome 17 at 70,846,173 bp
  • A to T, chromosome 18 at 21,652,136 bp
  • A to T, chromosome 18 at 22,411,499 bp
  • A to G, chromosome 18 at 22,517,540 bp
  • A to T, chromosome 18 at 23,960,358 bp
  • A to G, chromosome 18 at 61,805,064 bp
  • C to A, chromosome 18 at 65,957,052 bp
  • A to G, chromosome 19 at 5,105,201 bp
  • C to A, chromosome 19 at 12,469,658 bp
  • A to G, chromosome 19 at 41,086,234 bp
  • A to G, chromosome 19 at 53,233,146 bp
  • G to A, chromosome 19 at 61,119,212 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7231 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045342-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.