Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7231Btlr/Mmmh
Stock Number:
045342-MU
Citation ID:
RRID:MMRRC_045342-MU
Other Names:
R7231 (G1)
Major Collection:

Strain Information

Plekhj1
Name: pleckstrin homology domain containing, family J member 1
Synonyms: 9530063M10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 78670
VEGA: 10
Homologene: 11389
Dtx4
Name: deltex 4, E3 ubiquitin ligase
Synonyms: RNF155
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 207521
VEGA: 19
Homologene: 27781
Ptpn3
Name: protein tyrosine phosphatase, non-receptor type 3
Synonyms: PTPCL, 9530011I20Rik, PTP-H1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 545622
HGNC: HGNC:9655
Homologene: 74451
Suclg1
Name: succinate-CoA ligase, GDP-forming, alpha subunit
Synonyms: Sucla1, 1500000I01Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56451
Homologene: 55785
Ppp2r5d
Name: protein phosphatase 2, regulatory subunit B', delta
Synonyms: TEG-271, Tex271, B'delta
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21770
VEGA: 17
HGNC: HGNC:9312
Homologene: 37661
Hnrnpul1
Name: heterogeneous nuclear ribonucleoprotein U-like 1
Synonyms: E1B-AP5, E1BAP5, E130317O14Rik, Hnrnpul, Hnrpul1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232989
Homologene: 31419
Zc3h3
Name: zinc finger CCCH type containing 3
Synonyms: Smicl
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223642
VEGA: 15
Homologene: 9029
Slc39a1
Name: solute carrier family 39 (zinc transporter), member 1
Synonyms: zip1, Zirtl
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 30791
Homologene: 40906
Cyfip2
Name: cytoplasmic FMR1 interacting protein 2
Synonyms: Pir121, 6430511D02Rik, 1500004I01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76884
Homologene: 7936
Stxbp3
Name: syntaxin binding protein 3
Synonyms: Munc-18c, Stxbp3, Stxbp3a
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20912
Homologene: 5260
Ralgapa1
Name: Ral GTPase activating protein, alpha subunit 1
Synonyms: 4930400K19Rik, Tulip1, 2310003F20Rik, Garnl1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56784
VEGA: 12
Homologene: 84805
L3mbtl3
Name: L3MBTL3 histone methyl-lysine binding protein
Synonyms: MBT-1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237339
Homologene: 18226
Ankrd27
Name: ankyrin repeat domain 27
Synonyms: D330003H11Rik, Varp
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 245886
Homologene: 12956
Prkcq
Name: protein kinase C, theta
Synonyms: PKC-0, Pkcq, A130035A12Rik, PKC-theta, PKC theta, PKCtheta
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18761
HGNC: HGNC:9410
Homologene: 21263
Trf
Name: transferrin
Synonyms: Tfn, HP
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22041
Homologene: 68153
Tgif1
Name: TGFB-induced factor homeobox 1
Synonyms: Tgif
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21815
Homologene: 7574
Dlx1
Name: distal-less homeobox 1
Synonyms: DII B, Dlx, Dlx-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13390
HGNC: HGNC:2914
Homologene: 22558
Car12
Name: carbonic anhydrase 12
Synonyms: 2310047E01Rik, CA XII
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 76459
HGNC: HGNC:1371
Homologene: 20327
Vps13d
Name: vacuolar protein sorting 13D
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230895
Homologene: 15583
Strip2
Name: striatin interacting protein 2
Synonyms: Myoscape, D330017J20Rik, Fam40b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320609
Homologene: 66198
Runx2
Name: runt related transcription factor 2
Synonyms: AML3, polyomavirus enhancer binding factor 2 (PEBP2), SL3-3 enhancer factor 1, PEBP2 alpha A, PEBP2aA, Osf2, Cbfa1, Pebpa2a
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12393
Homologene: 68389
Pdia4
Name: protein disulfide isomerase associated 4
Synonyms: ERp72, Erp72, Cai, U48620
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12304
Homologene: 21020
Nelfa
Name: negative elongation factor complex member A, Whsc2
Synonyms: Whsc2h, Nelf-A, Whsc2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 24116
Homologene: 68478
Mbip
Name: MAP3K12 binding inhibitory protein 1
Synonyms: 4933408E06Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217588
VEGA: 12
Homologene: 9576
Haus8
Name: 4HAUS augmin-like complex, subunit 8
Synonyms: 2410004L22Rik, Hice1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76478
Homologene: 12644
Asxl3
Name: ASXL transcriptional regulator 3
Synonyms: LOC381127, D930044O18Rik, D430002O22Rik, C230079D11Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 211961
Homologene: 19371
Atp2b2
Name: ATPase, Ca++ transporting, plasma membrane 2
Synonyms: PMCA2, wms, D6Abb2e, jog, Tmy, Gena300
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11941
HGNC: HGNC:815
Homologene: 56150
Tas1r3
Name: taste receptor, type 1, member 3
Synonyms: T1r3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 83771
Homologene: 12890
Fli1
Name: Friend leukemia integration 1
Synonyms: Sic1, SIC-1, EWSR2, Fli-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14247
HGNC: HGNC:3749
Homologene: 55624
Isl1
Name: ISL1 transcription factor, LIM/homeodomain
Synonyms: Islet 1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16392
HGNC: HGNC:6132
Homologene: 1661
Abca13
Name: ATP-binding cassette, sub-family A member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268379
Homologene: 27991
Dennd5b
Name: DENN domain containing 5B
Synonyms: 9330160C06Rik, D030011O10Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320560
Homologene: 44911
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545370
Homologene: 23741
Dnah10
Name: dynein, axonemal, heavy chain 10
Synonyms: Dnahc10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56087
HGNC: HGNC:2941
Homologene: 25816
Fam20a
Name: FAM20A, golgi associated secretory pathway pseudokinase
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 208659
Homologene: 9719
Klhl14
Name: kelch-like 14
Synonyms: 6330403N15Rik, printor
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225266
Homologene: 28121
Ush2a
Name: usherin
Synonyms: MUSH2A, A930011D15Rik, LOC381317, LOC269160, A930037M10Rik, Ush2a, Ushrn
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22283
Homologene: 66151
Pkdrej
Name: polycystin (PKD) family receptor for egg jelly
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18766
VEGA: 15
HGNC: HGNC:9015
Homologene: 4427
Dnah9
Name: dynein, axonemal, heavy chain 9
Synonyms: D11Ertd686e, Dnahc9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237806
HGNC: HGNC:2953
Homologene: 20357
Nlrc5
Name: NLR family, CARD domain containing 5
Synonyms: AI451557
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 434341
Homologene: 88935
Umodl1
Name: uromodulin-like 1
Synonyms: D17Ertd488e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 52020
VEGA: 17
Homologene: 45466
Cgn
Name: cingulin
Synonyms: 6330408J11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 70737
Homologene: 41394
Cgnl1
Name: cingulin-like 1
Synonyms: Jacop, 4933421H10Rik, 9930020M10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68178
Homologene: 41901
Tulp4
Name: TUB like protein 4
Synonyms: 1110057P05Rik, 2210038L17Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68842
Homologene: 32467
Or56a3
Name: olfactory receptor family 56 subfamily A member 3
Synonyms: GA_x6K02T2PBJ9-7714499-7715446, MOR40-2, Olfr679
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259046
Homologene: 81538
Hsf4
Name: heat shock transcription factor 4
Synonyms: ldis1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 26386
HGNC: HGNC:5227
Homologene: 100128
Adamts15
Name: ADAM metallopeptidase with thrombospondin type 1 motif 15
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235130
VEGA: 9
Homologene: 8610
Tll2
Name: tolloid-like 2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 24087
VEGA: 19
Homologene: 56545
Ablim3
Name: actin binding LIM protein family, member 3
Synonyms: D930036B08Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 319713
VEGA: 18
Homologene: 69175
Slc26a4
Name: solute carrier family 26, member 4
Synonyms: Pds, pendrin
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 23985
VEGA: 12
HGNC: HGNC:8818
Homologene: 20132
Vwa5b2
Name: von Willebrand factor A domain containing 5B2
Synonyms: EG328644
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 328643
Homologene: 28056
Acvrl1
Name: activin A receptor, type II-like 1
Synonyms: Alk1, activin receptor-like kinase-1, Acvrlk1, Alk-1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11482
HGNC: HGNC:175
Homologene: 20058
Or2ag2b
Name: olfactory receptor family 2 subfamily AG member 2B
Synonyms: 4932441H21Rik, GA_x6K02T2PBJ9-9195805-9196755, MOR283-1, 4933433E02Rik, Olfr701
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66786
Homologene: 12558
Itih4
Name: inter alpha-trypsin inhibitor, heavy chain 4
Synonyms: Itih-4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16427
HGNC: HGNC:6169
Homologene: 1670
Triml1
Name: tripartite motif family-like 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244448
Homologene: 18619
Cyp4a32
Name: cytochrome P450, family 4, subfamily a, polypeptide 32
Synonyms: OTTMUSG00000008689
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100040843
HGNC: HGNC:2642
Homologene: 128044
Vmn1r74
Name: vomeronasal 1 receptor 74
Synonyms: V1rg5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 171240
Homologene: 110796
Rnf148
Name: ring finger protein 148
Synonyms: Greul3, 4933432M07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71300
Homologene: 82404
Mapk8ip2
Name: mitogen-activated protein kinase 8 interacting protein 2
Synonyms: JNK-interacting protein, Jip2, 3230402N03Rik, IB2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 60597
HGNC: HGNC:6883
Homologene: 8201
Vmn2r50
Name: vomeronasal 2, receptor 50
Synonyms: EG434117
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434117
Homologene: 113703
Rab1b
Name: RAB1B, member RAS oncogene family
Synonyms: 1110011F09Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 76308
VEGA: 19
Homologene: 128838
Lingo3
Name: leucine rich repeat and Ig domain containing 3
Synonyms: LERN2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237403
VEGA: 10
Homologene: 78065
Cplx4
Name: complexin 4
Synonyms: A930004D23Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225644
VEGA: 18
Homologene: 17150
Or4f59
Name: olfactory receptor family 4 subfamily F member 59
Synonyms: GA_x6K02T2Q125-73090482-73089529, MOR245-20, Olfr1312
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258359
Homologene: 128122
Pde2a
Name: phosphodiesterase 2A, cGMP-stimulated
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 207728
HGNC: HGNC:8777
Homologene: 1952
Cmtr2
Name: cap methyltransferase 2
Synonyms: C730036L12Rik, Ftsjd1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234728
Homologene: 10144
Tmem181a
Name: transmembrane protein 181A
Synonyms: 5930418K15Rik, Gpr178, C76977, Tmem181
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 77106
Homologene: 44787
Lrrc36
Name: leucine rich repeat containing 36
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270091
Homologene: 23090
Snx21
Name: sorting nexin family member 21
Synonyms: 5730407K14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 101113
Homologene: 43132
Vmn2r38
Name: vomeronasal 2, receptor 38
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434110
Homologene: 113703
Samd15
Name: sterile alpha motif domain containing 15
Synonyms: LOC238333, Gm263
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238333
Homologene: 52875
Nherf2
Name: NHERF family PDZ scaffold protein 2
Synonyms: Nherf2, Octs2, Tka-1, Sip-1, E3karp, 1200011K07Rik, Sip1, 2010007A20Rik, 0610011L07Rik, Sryip1, Slc9a3r2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 65962
VEGA: 17
Homologene: 56962
Zfp397
Name: zinc finger protein 397
Synonyms: 2810411K16Rik, 6720480F11Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 69256
VEGA: 18
Homologene: 117445
Trav23
Name: T cell receptor alpha variable 23
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100113481
Or7e171-ps1
Name: olfactory receptor family 7 subfamily E member 171, pseudogene 1
Synonyms: GA_x6K02T2PVTD-13682249-13681321, MOR146-5P, MOR146-11_p, Olfr863-ps1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258070
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 150,638,876 bp
  • CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC to CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC, chromosome 1 at 174,609,203 bp
  • A to G, chromosome 1 at 188,759,763 bp
  • T to A, chromosome 2 at 11,290,451 bp
  • T to A, chromosome 2 at 71,532,496 bp
  • A to T, chromosome 2 at 112,042,366 bp
  • T to C, chromosome 2 at 164,786,201 bp
  • C to A, chromosome 3 at 90,251,790 bp
  • T to A, chromosome 3 at 94,773,192 bp
  • G to A, chromosome 3 at 108,800,809 bp
  • T to A, chromosome 4 at 57,245,062 bp
  • T to C, chromosome 4 at 115,609,697 bp
  • A to G, chromosome 4 at 145,057,462 bp
  • T to C, chromosome 4 at 155,862,826 bp
  • C to A, chromosome 5 at 32,901,865 bp
  • C to T, chromosome 5 at 33,898,825 bp
  • A to T, chromosome 5 at 124,813,828 bp
  • G to T, chromosome 6 at 23,654,891 bp
  • A to G, chromosome 6 at 29,944,487 bp
  • A to T, chromosome 6 at 47,800,957 bp
  • G to A, chromosome 6 at 73,263,971 bp
  • G to A, chromosome 6 at 113,765,732 bp
  • C to T, chromosome 6 at 149,044,604 bp
  • C to T, chromosome 7 at 9,097,638 bp
  • A to T, chromosome 7 at 10,053,083 bp
  • A to T, chromosome 7 at 11,846,961 bp
  • G to A, chromosome 7 at 25,748,417 bp
  • A to G, chromosome 7 at 35,628,446 bp
  • A to G, chromosome 7 at 101,505,953 bp
  • T to C, chromosome 7 at 105,085,787 bp
  • A to T, chromosome 7 at 106,818,443 bp
  • A to G, chromosome 7 at 141,360,392 bp
  • T to C, chromosome 8 at 43,136,371 bp
  • G to A, chromosome 8 at 71,253,137 bp
  • T to A, chromosome 8 at 94,521,805 bp
  • C to T, chromosome 8 at 105,272,147 bp
  • T to C, chromosome 8 at 105,461,057 bp
  • T to C, chromosome 8 at 110,222,546 bp
  • T to A, chromosome 9 at 19,941,559 bp
  • C to A, chromosome 9 at 30,906,158 bp
  • T to C, chromosome 9 at 32,424,188 bp
  • T to C, chromosome 9 at 66,752,317 bp
  • C to T, chromosome 9 at 71,632,645 bp
  • C to A, chromosome 9 at 103,225,148 bp
  • T to A, chromosome 10 at 26,339,282 bp
  • T to G, chromosome 10 at 80,797,658 bp
  • T to A, chromosome 10 at 80,835,104 bp
  • A to T, chromosome 11 at 9,294,175 bp
  • T to C, chromosome 11 at 46,224,136 bp
  • T to C, chromosome 11 at 65,965,647 bp
  • T to C, chromosome 11 at 109,721,375 bp
  • T to A, chromosome 12 at 31,547,946 bp
  • A to G, chromosome 12 at 55,604,191 bp
  • A to G, chromosome 12 at 56,337,762 bp
  • T to A, chromosome 12 at 87,201,044 bp
  • A to G, chromosome 12 at 113,288,016 bp
  • A to G, chromosome 13 at 116,303,290 bp
  • A to T, chromosome 14 at 30,896,614 bp
  • A to T, chromosome 14 at 53,977,568 bp
  • C to T, chromosome 15 at 75,840,382 bp
  • T to C, chromosome 15 at 85,206,152 bp
  • C to A, chromosome 15 at 85,816,188 bp
  • T to G, chromosome 15 at 89,458,076 bp
  • T to A, chromosome 15 at 101,136,223 bp
  • A to G, chromosome 16 at 20,604,128 bp
  • T to C, chromosome 17 at 6,236,235 bp
  • T to C, chromosome 17 at 6,297,920 bp
  • C to T, chromosome 17 at 24,650,104 bp
  • G to A, chromosome 17 at 30,986,116 bp
  • G to A, chromosome 17 at 44,814,192 bp
  • A to T, chromosome 17 at 46,684,060 bp
  • T to A, chromosome 17 at 70,846,173 bp
  • A to T, chromosome 18 at 21,652,136 bp
  • A to T, chromosome 18 at 22,411,499 bp
  • A to G, chromosome 18 at 22,517,540 bp
  • A to T, chromosome 18 at 23,960,358 bp
  • A to G, chromosome 18 at 61,805,064 bp
  • C to A, chromosome 18 at 65,957,052 bp
  • A to G, chromosome 19 at 5,105,201 bp
  • C to A, chromosome 19 at 12,469,658 bp
  • A to G, chromosome 19 at 41,086,234 bp
  • A to G, chromosome 19 at 53,233,146 bp
  • G to A, chromosome 19 at 61,119,212 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7231 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045342-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.