Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7298Btlr/Mmmh
Stock Number:
045402-MU
Citation ID:
RRID:MMRRC_045402-MU
Other Names:
R7298 (G1)
Major Collection:

Strain Information

Scrib
Name: scribbled planar cell polarity
Synonyms: Scrb1, Crc
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105782
Homologene: 44228
Rngtt
Name: RNA guanylyltransferase and 5'-phosphatase
Synonyms: mouse capping enzyme
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 24018
Homologene: 37851
Rev1
Name: REV1, DNA directed polymerase
Synonyms: REV1, 1110027I23Rik, Rev1l
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 56210
Homologene: 32309
Ranbp9
Name: RAN binding protein 9
Synonyms: IBAP-1, RanBPM
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 56705
VEGA: 13
Homologene: 38057
Zgrf1
Name: zinc finger, GRF-type containing 1
Synonyms: 4930422G04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71643
Homologene: 34708
Rbbp6
Name: retinoblastoma binding protein 6, ubiquitin ligase
Synonyms: 4933422O15Rik, C030034J04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19647
HGNC: HGNC:9889
Homologene: 136812
Uhrf2
Name: ubiquitin-like, containing PHD and RING finger domains 2
Synonyms: 2310065A22Rik, Nirf, D130071B19Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 109113
Homologene: 17001
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 38,053,104 bp
  • T to A, chromosome 1 at 69,919,426 bp
  • T to C, chromosome 2 at 89,816,521 bp
  • G to T, chromosome 3 at 63,716,037 bp
  • C to T, chromosome 3 at 92,850,176 bp
  • T to C, chromosome 3 at 103,735,860 bp
  • A to G, chromosome 3 at 107,219,693 bp
  • A to G, chromosome 3 at 125,915,416 bp
  • C to A, chromosome 3 at 127,583,650 bp
  • G to T, chromosome 4 at 33,362,927 bp
  • T to C, chromosome 4 at 101,606,611 bp
  • G to T, chromosome 4 at 106,735,528 bp
  • A to G, chromosome 4 at 141,746,964 bp
  • C to A, chromosome 4 at 143,698,505 bp
  • T to A, chromosome 5 at 30,388,270 bp
  • T to A, chromosome 7 at 3,895,265 bp
  • TCCCAGG to T, chromosome 7 at 80,098,331 bp
  • T to A, chromosome 7 at 86,394,923 bp
  • T to A, chromosome 7 at 86,800,771 bp
  • G to A, chromosome 7 at 105,755,131 bp
  • A to T, chromosome 7 at 120,207,883 bp
  • A to G, chromosome 7 at 123,001,194 bp
  • A to G, chromosome 7 at 135,683,287 bp
  • T to C, chromosome 8 at 15,098,411 bp
  • A to C, chromosome 8 at 105,382,984 bp
  • T to C, chromosome 9 at 7,560,448 bp
  • C to T, chromosome 9 at 21,108,860 bp
  • C to T, chromosome 9 at 50,779,061 bp
  • G to A, chromosome 9 at 108,662,144 bp
  • C to T, chromosome 9 at 119,151,847 bp
  • T to A, chromosome 10 at 61,666,912 bp
  • A to T, chromosome 12 at 115,952,954 bp
  • A to G, chromosome 13 at 43,480,460 bp
  • T to G, chromosome 13 at 55,130,603 bp
  • C to A, chromosome 13 at 55,593,294 bp
  • T to A, chromosome 13 at 74,372,394 bp
  • A to T, chromosome 14 at 31,616,486 bp
  • G to A, chromosome 14 at 53,649,785 bp
  • C to A, chromosome 14 at 101,729,525 bp
  • A to C, chromosome 15 at 76,064,761 bp
  • T to C, chromosome 16 at 10,209,168 bp
  • A to G, chromosome 16 at 14,396,472 bp
  • A to T, chromosome 16 at 44,481,412 bp
  • A to T, chromosome 16 at 46,448,396 bp
  • A to G, chromosome 16 at 48,872,874 bp
  • G to A, chromosome 16 at 85,899,918 bp
  • T to C, chromosome 17 at 25,299,763 bp
  • T to A, chromosome 17 at 26,962,987 bp
  • T to C, chromosome 17 at 87,442,737 bp
  • C to A, chromosome 19 at 8,621,320 bp
  • C to T, chromosome 19 at 11,790,048 bp
  • A to G, chromosome 19 at 30,088,549 bp
  • TCGGGGCCGGGGCCGGGGCCG to TCGGGGCCGGGGCCGGGGCCGGGGCCG, chromosome X at 101,794,171 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7298 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045402-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.