Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7298Btlr/Mmmh
Stock Number:
045402-MU
Citation ID:
RRID:MMRRC_045402-MU
Other Names:
R7298 (G1)
Major Collection:

Strain Information

Scrib
Name: scribbled planar cell polarity
Synonyms: Scrb1, Crc
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105782
Homologene: 44228
Rngtt
Name: RNA guanylyltransferase and 5'-phosphatase
Synonyms: mouse capping enzyme
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 24018
Homologene: 37851
Rev1
Name: REV1, DNA directed polymerase
Synonyms: REV1, 1110027I23Rik, Rev1l
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 56210
Homologene: 32309
Ranbp9
Name: RAN binding protein 9
Synonyms: IBAP-1, RanBPM
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 56705
VEGA: 13
Homologene: 38057
Zgrf1
Name: zinc finger, GRF-type containing 1
Synonyms: 4930422G04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71643
Homologene: 34708
Rbbp6
Name: retinoblastoma binding protein 6, ubiquitin ligase
Synonyms: 4933422O15Rik, C030034J04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19647
HGNC: HGNC:9889
Homologene: 136812
Uhrf2
Name: ubiquitin-like, containing PHD and RING finger domains 2
Synonyms: 2310065A22Rik, Nirf, D130071B19Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 109113
Homologene: 17001
Stx3
Name: syntaxin 3
Synonyms: syntaxin 3B, syntaxin 3A, Syn-3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20908
Homologene: 80191
Nectin3
Name: nectin cell adhesion molecule 3
Synonyms: nectin-3, 4921513D19Rik, 2610301B19Rik, 3000002N23Rik, Pvrl3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 58998
Homologene: 9162
Syngap1
Name: synaptic Ras GTPase activating protein 1 homolog (rat)
Synonyms: Syngap
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240057
Homologene: 84739
Fam151a
Name: family with sequence simliarity 151, member A
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230579
Homologene: 17143
Ppa1
Name: pyrophosphatase (inorganic) 1
Synonyms: 2010317E03Rik, Pyp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67895
HGNC: HGNC:9226
Homologene: 5356
Calm2
Name: calmodulin 2
Synonyms: 1500001E21Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12314
HGNC: HGNC:1445
Homologene: 116117
Zfp346
Name: zinc finger protein 346
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 26919
Homologene: 8073
Atf7ip2
Name: activating transcription factor 7 interacting protein 2
Synonyms: 4930558K11Rik, PSM2, Get-1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 75329
Homologene: 23509
Slc25a20
Name: solute carrier family 25 (mitochondrial carnitine/acylcarnitine translocase), member 20
Synonyms: mCAC, Cact, 1110007P09Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 57279
HGNC: HGNC:1421
Homologene: 331
Dnajc6
Name: DnaJ heat shock protein family (Hsp40) member C6
Synonyms: 2810027M23Rik, auxilin
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72685
Homologene: 8865
Idh2
Name: isocitrate dehydrogenase 2 (NADP+), mitochondrial
Synonyms: Idh-2, IDPm
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269951
HGNC: HGNC:5383
Homologene: 37590
Dchs1
Name: dachsous cadherin related 1
Synonyms: C130033F22Rik, 3110041P15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233651
Homologene: 2771
Kctd19
Name: potassium channel tetramerisation domain containing 19
Synonyms: 4922504H04Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 279499
Homologene: 18630
Cfap44
Name: cilia and flagella associated protein 44
Synonyms: 6330444M21Rik, D16Ertd642e, Wdr52
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 212517
Homologene: 75085
Ugt8a
Name: UDP galactosyltransferase 8A
Synonyms: Cgt, mCerGT, Ugt8
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 22239
Homologene: 20715
Vmn2r77
Name: vomeronasal 2, receptor 77
Synonyms: EG546983
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 546983
Homologene: 115466
Spag16
Name: sperm associated antigen 16
Synonyms: Pf20, 4930524F24Rik, 4930585K05Rik, Wdr29, 4921511D23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66722
Homologene: 11572
Prss34
Name: serine protease 34
Synonyms: mast cell protease 11, mMcp-11
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 328780
VEGA: 17
Homologene: 55542
Abca14
Name: ATP-binding cassette, sub-family A member 14
Synonyms: 1700110B15Rik, 4930539G24Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67928
Homologene: 86128
Olfml3
Name: olfactomedin-like 3
Synonyms: HNOEL-iso, 2810002E22Rik, mONT3, ONT3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99543
Homologene: 10613
Ptpre
Name: protein tyrosine phosphatase receptor type E
Synonyms: PTPe, PTPepsilon, RPTPepsilon
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19267
HGNC: HGNC:9669
Homologene: 31387
Gm9922
Name: predicted gene 9922
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 102633345
VEGA: 14
Mmp8
Name: matrix metallopeptidase 8
Synonyms: Collagenase-2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17394
VEGA: 9
HGNC: HGNC:7175
Homologene: 22482
Abcc1
Name: ATP-binding cassette, sub-family C member 1
Synonyms: MRP, Mdrap, Mrp1, Abcc1b, Abcc1a
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17250
HGNC: HGNC:51
Homologene: 133779
Acaa1b
Name: acetyl-Coenzyme A acyltransferase 1B
Synonyms: thiolase B
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235674
HGNC: HGNC:82
Homologene: 91131
Plch1
Name: phospholipase C, eta 1
Synonyms: PLCeta1, Plcl3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 269437
Homologene: 88833
Tyk2
Name: tyrosine kinase 2
Synonyms: JTK1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 54721
VEGA: 9
Homologene: 20712
Adamts5
Name: ADAM metallopeptidase with thrombospondin type 1 motif 5
Synonyms: ADAM-TS5, 9530092O11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 23794
VEGA: 16
HGNC: HGNC:221
Homologene: 5109
Hacl1
Name: 2-hydroxyacyl-CoA lyase 1
Synonyms: Hpcl, 1600020H07Rik, Phyh2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 56794
Homologene: 5794
Zfp72
Name: zinc finger protein 72
Synonyms: Zfp74
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238722
VEGA: 13
Homologene: 108290
Or4c12b
Name: olfactory receptor family 4 subfamily C member 12B
Synonyms: GA_x6K02T2Q125-51257221-51258135, MOR232-4, Olfr1255
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258979
Homologene: 82298
Slc22a6
Name: solute carrier family 22 (organic anion transporter), member 6
Synonyms: NKT, Oat1, Orctl1, mOat1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18399
VEGA: 19
Homologene: 16813
Retnlg
Name: resistin like gamma
Synonyms: Fizz3, Relmg, Xcp1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 245195
VEGA: 16
Homologene: 138458
Alg9
Name: ALG9 alpha-1,2-mannosyltransferase
Synonyms: 8230402H15Rik, B430313H07Rik, Dibd1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102580
Homologene: 6756
Or6aa1
Name: olfactory receptor family 6 subfamily AA member 1
Synonyms: GA_x6K02T2NHDJ-9712819-9713778, MOR104-2, Olfr303
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258612
Homologene: 105157
Cym
Name: chymosin
Synonyms: LOC229697, Gm131
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229697
Homologene: 129841
Agmat
Name: agmatinase
Synonyms: 5033405N08Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 75986
Homologene: 99855
Tmed9
Name: transmembrane p24 trafficking protein 9
Synonyms: 2400003B06Rik, p24alpha2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67511
VEGA: 13
Homologene: 68707
Ighv1-82
Name: immunoglobulin heavy variable 1-82
Synonyms: Gm16747
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100775175
HGNC: HGNC:5553
Trav15-2-dv6-2
Name: T cell receptor alpha variable 15-2-DV6-2
Synonyms: Trav15-2/dv6-2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 436545
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 38,053,104 bp
  • T to A, chromosome 1 at 69,919,426 bp
  • T to C, chromosome 2 at 89,816,521 bp
  • G to T, chromosome 3 at 63,716,037 bp
  • C to T, chromosome 3 at 92,850,176 bp
  • T to C, chromosome 3 at 103,735,860 bp
  • A to G, chromosome 3 at 107,219,693 bp
  • A to G, chromosome 3 at 125,915,416 bp
  • C to A, chromosome 3 at 127,583,650 bp
  • G to T, chromosome 4 at 33,362,927 bp
  • T to C, chromosome 4 at 101,606,611 bp
  • G to T, chromosome 4 at 106,735,528 bp
  • A to G, chromosome 4 at 141,746,964 bp
  • C to A, chromosome 4 at 143,698,505 bp
  • T to A, chromosome 5 at 30,388,270 bp
  • T to A, chromosome 7 at 3,895,265 bp
  • TCCCAGG to T, chromosome 7 at 80,098,331 bp
  • T to A, chromosome 7 at 86,394,923 bp
  • T to A, chromosome 7 at 86,800,771 bp
  • G to A, chromosome 7 at 105,755,131 bp
  • A to T, chromosome 7 at 120,207,883 bp
  • A to G, chromosome 7 at 123,001,194 bp
  • A to G, chromosome 7 at 135,683,287 bp
  • T to C, chromosome 8 at 15,098,411 bp
  • A to C, chromosome 8 at 105,382,984 bp
  • T to C, chromosome 9 at 7,560,448 bp
  • C to T, chromosome 9 at 21,108,860 bp
  • C to T, chromosome 9 at 50,779,061 bp
  • G to A, chromosome 9 at 108,662,144 bp
  • C to T, chromosome 9 at 119,151,847 bp
  • T to A, chromosome 10 at 61,666,912 bp
  • A to T, chromosome 12 at 115,952,954 bp
  • A to G, chromosome 13 at 43,480,460 bp
  • T to G, chromosome 13 at 55,130,603 bp
  • C to A, chromosome 13 at 55,593,294 bp
  • T to A, chromosome 13 at 74,372,394 bp
  • A to T, chromosome 14 at 31,616,486 bp
  • G to A, chromosome 14 at 53,649,785 bp
  • C to A, chromosome 14 at 101,729,525 bp
  • A to C, chromosome 15 at 76,064,761 bp
  • T to C, chromosome 16 at 10,209,168 bp
  • A to G, chromosome 16 at 14,396,472 bp
  • A to T, chromosome 16 at 44,481,412 bp
  • A to T, chromosome 16 at 46,448,396 bp
  • A to G, chromosome 16 at 48,872,874 bp
  • G to A, chromosome 16 at 85,899,918 bp
  • T to C, chromosome 17 at 25,299,763 bp
  • T to A, chromosome 17 at 26,962,987 bp
  • T to C, chromosome 17 at 87,442,737 bp
  • C to A, chromosome 19 at 8,621,320 bp
  • C to T, chromosome 19 at 11,790,048 bp
  • A to G, chromosome 19 at 30,088,549 bp
  • TCGGGGCCGGGGCCGGGGCCG to TCGGGGCCGGGGCCGGGGCCGGGGCCG, chromosome X at 101,794,171 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7298 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045402-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.