Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7339Btlr/Mmmh
Stock Number:
045429-MU
Citation ID:
RRID:MMRRC_045429-MU
Other Names:
R7339 (G1)
Major Collection:

Strain Information

Trp53
Name: transformation related protein 53
Synonyms: p53, p44
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22059
Homologene: 460
Pald1
Name: phosphatase domain containing, paladin 1
Synonyms: paladin, X99384
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 27355
VEGA: 10
Homologene: 8453
Wsb1
Name: WD repeat and SOCS box-containing 1
Synonyms: 2700038M07Rik, 1110056B13Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78889
Homologene: 9218
Foxa3
Name: forkhead box A3
Synonyms: Tcf-3g, Hnf3g, Hnf-3g, Tcf3g
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15377
HGNC: HGNC:5023
Homologene: 3308
Atp1a1
Name: ATPase, Na+/K+ transporting, alpha 1 polypeptide
Synonyms: Atpa-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11928
HGNC: HGNC:799
Homologene: 564
Barhl1
Name: BarH like homeobox 1
Synonyms: Dres115, MBH2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 54422
HGNC: HGNC:953
Homologene: 81871
Trp53bp1
Name: transformation related protein 53 binding protein 1
Synonyms: 53BP1, p53BP1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27223
Homologene: 4137
Nek6
Name: NIMA (never in mitosis gene a)-related expressed kinase 6
Synonyms: 1300007C09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 59126
HGNC: HGNC:7749
Homologene: 49379
Vps35l
Name: VPS35 endosomal protein sorting factor like
Synonyms: 9030624J02Rik, Vsp35l
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71517
Homologene: 10659
Chmp2b
Name: charged multivesicular body protein 2B
Synonyms: 1190006E07Rik, chromatin modifying protein 2B
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 68942
VEGA: 16
Homologene: 8534
Ncapg2
Name: non-SMC condensin II complex, subunit G2
Synonyms: Mtb, 5830426I05Rik, Luzp5, mCAP-G2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 76044
VEGA: 12
Homologene: 9820
Metap1
Name: methionyl aminopeptidase 1
Synonyms: 1700029C17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 75624
Homologene: 6488
Fbxo42
Name: F-box protein 42
Synonyms: 6720460I06Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 213499
Homologene: 16234
Urb1
Name: URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Synonyms: 5730405K23Rik, 4921511H13Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207932
Homologene: 45941
Lrp6
Name: low density lipoprotein receptor-related protein 6
Synonyms: skam26Jus, Cd, ska26, skax26
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16974
HGNC: HGNC:6698
Homologene: 1747
Cfap36
Name: cilia and flagella associated protein 36
Synonyms: 4931428D14Rik, Ccdc104
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216618
Homologene: 41646
Zfp318
Name: zinc finger protein 318
Synonyms: TZF, 2610034E08Rik, D530032D06Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 57908
Homologene: 22808
Tmx1
Name: thioredoxin-related transmembrane protein 1
Synonyms: 2810425A04Rik, Txndc1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 72736
Homologene: 12482
Vps13d
Name: vacuolar protein sorting 13D
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230895
Homologene: 15583
Casz1
Name: castor zinc finger 1
Synonyms: 2410019P08Rik, D4Ertd432e, castor, Cst
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69743
Homologene: 9824
Ms4a6d
Name: membrane-spanning 4-domains, subfamily A, member 6D
Synonyms: Ms4a11
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 68774
Homologene: 130755
2900026A02Rik
Name: RIKEN cDNA 2900026A02 gene
Synonyms: LOC231620, Gm449
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243219
Homologene: 129566
Zfc3h1
Name: zinc finger, C3H1-type containing
Synonyms: Psrc2, Ccdc131
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216345
Homologene: 17017
Ttll5
Name: tubulin tyrosine ligase-like family, member 5
Synonyms: 4930556H18Rik, 1700048H13Rik, 2310009M18Rik, D630041K24Rik, STAMP
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320244
Homologene: 9013
Myh6
Name: myosin, heavy polypeptide 6, cardiac muscle, alpha
Synonyms: alpha myosin, Myhc-a, alpha cardiac MHC, cardiomyopathy, hypertrophic 1, Myhca, A830009F23Rik, alpha-MHC, alphaMHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 17888
HGNC: HGNC:7576
Homologene: 124414
Nell1
Name: NEL-like 1
Synonyms: B230343H07Rik, l7R6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 338352
HGNC: HGNC:7750
Homologene: 4486
Bltp2
Name: bridge-like lipid transfer protein family member 2
Synonyms: 2610507B11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72503
Homologene: 34730
Dnah12
Name: dynein, axonemal, heavy chain 12
Synonyms: Hdhc3, HL-19, DLP12, HL19, DHC3, LOC380889, 4921531P07Rik, Dnahc7l, Dnahc12
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110083
HGNC: HGNC:2943
Homologene: 56821
Slc35b4
Name: solute carrier family 35, member B4
Synonyms: 4930474D06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 58246
Homologene: 5799
Ccdc175
Name: coiled-coil domain containing 175
Synonyms: 4930403N07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 73936
VEGA: 12
Homologene: 79144
Or4f6
Name: olfactory receptor family 4 subfamily F member 6
Synonyms: GA_x6K02T2Q125-73056609-73055671, MOR245-3, Olfr1310
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258441
Homologene: 74053
Nlrp2
Name: NLR family, pyrin domain containing 2
Synonyms: PYPAF2, E330007A02Rik, Nalp2, Pan1, Nbs1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232827
Homologene: 56789
Abcb11
Name: ATP-binding cassette, sub-family B member 11
Synonyms: PFIC2, ABC16, PGY4, Lith1, sister of P-glycoprotein, Bsep
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27413
HGNC: HGNC:42
Homologene: 74509
Naip6
Name: NLR family, apoptosis inhibitory protein 6
Synonyms: Naip-rs4A, Naip-rs4, Birc1f
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17952
HGNC: HGNC:7634
Homologene: 113589
Arhgap5
Name: Rho GTPase activating protein 5
Synonyms: p190-B, p190B
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 11855
VEGA: 12
HGNC: HGNC:675
Homologene: 907
Hsd3b5
Name: hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 5
Synonyms: 3(beta)HSDV
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 15496
Homologene: 104115
Ahnak
Name: AHNAK nucleoprotein
Synonyms: DY6, 2310047C17Rik, 1110004P15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66395
VEGA: 19
HGNC: HGNC:347
Homologene: 67425
Dennd5a
Name: DENN domain containing 5A
Synonyms: ORF37, 1500012B19Rik, Rab6ip1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19347
Homologene: 14584
Or4f57
Name: olfactory receptor family 4 subfamily F member 57
Synonyms: GA_x6K02T2Q125-73008844-73007882, MOR245-22, Olfr1308
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258258
Homologene: 45797
Cps1
Name: carbamoyl-phosphate synthetase 1
Synonyms: CPS, CPSase I, 4732433M03Rik, D1Ucla3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227231
HGNC: HGNC:2323
Homologene: 68208
Or2y17
Name: olfactory receptor family 2 subfamily Y member 17
Synonyms: GA_x6K02T2QP88-6094111-6093176, MOR256-2, Olfr1390
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 259068
Gabbr2
Name: gamma-aminobutyric acid type B receptor subunit 2
Synonyms: Gababr2, LOC242425, Gpr51, GB2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242425
HGNC: HGNC:4507
Homologene: 55902
Spdef
Name: SAM pointed domain containing ets transcription factor
Synonyms: PDEF, Pse
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 30051
Homologene: 8231
Cactin
Name: cactin, spliceosome C complex subunit
Synonyms: 2510012J08Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70312
VEGA: 10
Homologene: 69553
Fcgr1
Name: Fc receptor, IgG, high affinity I
Synonyms: CD64, FcgammaRI
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14129
Homologene: 475
Ptdss1
Name: phosphatidylserine synthase 1
Synonyms: PtdSer Synthase-1, PSS-1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19210
VEGA: 13
HGNC: HGNC:9587
Homologene: 7494
Gbp10
Name: guanylate-binding protein 10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 626578
Homologene: 128731
Arid3c
Name: AT-rich interaction domain 3C
Synonyms: OTTMUSG00000006683
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 550619
Homologene: 72499
Slc38a11
Name: solute carrier family 38, member 11
Synonyms: 9330158F14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320106
Homologene: 5775
Spata31e3
Name: spermatogenesis associated 31 subfamily E member 3
Synonyms: LOC380882, Gm906
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 380882
VEGA: 13
Homologene: 134512
Or52n4b
Name: olfactory receptor family 52 subfamily N member 4B
Synonyms: GA_x6K02T2PBJ9-10874315-10875286, MOR34-9, MOR34-8P, MOR34-12, MOR34-9, Olfr1548, Olfr503
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259143
Homologene: 121509
Mkrn3
Name: makorin, ring finger protein, 3
Synonyms: D7H15S9-1, Zfp127
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22652
HGNC: HGNC:7114
Homologene: 4143
Padi1
Name: peptidyl arginine deiminase, type I
Synonyms: Pdi1, Pad type 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18599
Homologene: 7881
Or13j1
Name: olfactory receptor family 13 subfamily J member 1
Synonyms: mOR17, MOR262-4, GA_x6K02T2N78B-16230286-16231224, Olfr71
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56015
Homologene: 10460
Tgoln1
Name: trans-golgi network protein
Synonyms: TGN38A, TGN38, Ttgn1, D6Ertd384e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22134
Homologene: 137224
Pla2g4d
Name: phospholipase A2, group IVD
Synonyms: 2610311B01Rik, Pla2delta
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78390
Homologene: 52252
Amz1
Name: archaelysin family metallopeptidase 1
Synonyms: 6530401C20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231842
Homologene: 18290
Otop3
Name: otopetrin 3
Synonyms: 2310011E08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69602
Homologene: 26091
Vmn2r43
Name: vomeronasal 2, receptor 43
Synonyms: EC2-V2R
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381838
Homologene: 113703
Rrh
Name: retinal pigment epithelium derived rhodopsin homolog
Synonyms: Peropsin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20132
Homologene: 55977
Trav13n-4
Name: T cell receptor alpha variable 13N-4
Synonyms: ENSMUSG00000072517, Gm10907
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100126460
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 67,197,015 bp
  • T to C, chromosome 2 at 28,909,887 bp
  • G to A, chromosome 2 at 38,560,965 bp
  • C to T, chromosome 2 at 65,326,570 bp
  • C to T, chromosome 2 at 69,299,867 bp
  • A to T, chromosome 2 at 111,960,611 bp
  • A to G, chromosome 2 at 112,008,475 bp
  • T to C, chromosome 2 at 120,278,978 bp
  • T to C, chromosome 2 at 121,236,469 bp
  • C to T, chromosome 3 at 96,284,299 bp
  • A to G, chromosome 3 at 98,622,074 bp
  • T to C, chromosome 3 at 101,589,872 bp
  • A to T, chromosome 3 at 129,810,613 bp
  • T to C, chromosome 3 at 138,466,137 bp
  • A to G, chromosome 4 at 41,729,883 bp
  • C to T, chromosome 4 at 43,706,080 bp
  • T to C, chromosome 4 at 46,846,340 bp
  • T to C, chromosome 4 at 140,829,234 bp
  • T to G, chromosome 4 at 141,200,144 bp
  • C to T, chromosome 4 at 145,121,368 bp
  • T to A, chromosome 4 at 148,951,745 bp
  • C to A, chromosome 5 at 44,101,653 bp
  • T to C, chromosome 5 at 105,220,098 bp
  • T to C, chromosome 5 at 113,183,072 bp
  • A to G, chromosome 5 at 140,741,551 bp
  • A to G, chromosome 6 at 34,167,656 bp
  • G to C, chromosome 6 at 72,616,278 bp
  • G to T, chromosome 6 at 134,450,818 bp
  • T to A, chromosome 7 at 5,327,628 bp
  • A to T, chromosome 7 at 8,255,307 bp
  • A to T, chromosome 7 at 19,014,869 bp
  • T to C, chromosome 7 at 50,279,549 bp
  • C to T, chromosome 7 at 62,419,782 bp
  • A to C, chromosome 7 at 108,544,900 bp
  • A to G, chromosome 7 at 109,901,159 bp
  • A to T, chromosome 7 at 118,809,971 bp
  • T to G, chromosome 9 at 21,286,587 bp
  • T to C, chromosome 10 at 61,323,331 bp
  • CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG to CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG, chromosome 10 at 81,321,318 bp
  • A to G, chromosome 10 at 115,403,300 bp
  • T to C, chromosome 11 at 29,225,925 bp
  • G to A, chromosome 11 at 49,341,048 bp
  • T to C, chromosome 11 at 69,589,189 bp
  • G to A, chromosome 11 at 78,272,384 bp
  • A to G, chromosome 11 at 79,240,358 bp
  • T to A, chromosome 11 at 115,346,378 bp
  • A to G, chromosome 12 at 52,517,698 bp
  • A to G, chromosome 12 at 70,458,850 bp
  • C to A, chromosome 12 at 72,136,041 bp
  • T to C, chromosome 12 at 85,857,464 bp
  • A to G, chromosome 12 at 116,414,834 bp
  • A to T, chromosome 13 at 50,247,168 bp
  • A to G, chromosome 13 at 66,963,362 bp
  • G to T, chromosome 13 at 100,316,019 bp
  • A to T, chromosome 14 at 26,872,320 bp
  • A to T, chromosome 14 at 53,363,978 bp
  • T to C, chromosome 14 at 54,961,568 bp
  • G to A, chromosome 16 at 65,545,346 bp
  • CACTTAC to CAC, chromosome 16 at 90,772,573 bp
  • C to T, chromosome 17 at 8,757,028 bp
  • T to A, chromosome 17 at 27,720,245 bp
  • T to C, chromosome 17 at 46,411,247 bp
  • A to T, chromosome 19 at 9,008,165 bp
  • G to A, chromosome 19 at 11,590,073 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7339 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045429-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.