Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7339Btlr/Mmmh
Stock Number:
045429-MU
Citation ID:
RRID:MMRRC_045429-MU
Other Names:
R7339 (G1)
Major Collection:

Strain Information

Trp53
Name: transformation related protein 53
Synonyms: p53, p44
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22059
Homologene: 460
Pald1
Name: phosphatase domain containing, paladin 1
Synonyms: paladin, X99384
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 27355
VEGA: 10
Homologene: 8453
Wsb1
Name: WD repeat and SOCS box-containing 1
Synonyms: 2700038M07Rik, 1110056B13Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78889
Homologene: 9218
Foxa3
Name: forkhead box A3
Synonyms: Tcf-3g, Hnf3g, Hnf-3g, Tcf3g
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15377
HGNC: HGNC:5023
Homologene: 3308
Atp1a1
Name: ATPase, Na+/K+ transporting, alpha 1 polypeptide
Synonyms: Atpa-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11928
HGNC: HGNC:799
Homologene: 564
Barhl1
Name: BarH like homeobox 1
Synonyms: Dres115, MBH2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 54422
HGNC: HGNC:953
Homologene: 81871
Trp53bp1
Name: transformation related protein 53 binding protein 1
Synonyms: 53BP1, p53BP1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27223
Homologene: 4137
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 67,197,015 bp
  • T to C, chromosome 2 at 28,909,887 bp
  • G to A, chromosome 2 at 38,560,965 bp
  • C to T, chromosome 2 at 65,326,570 bp
  • C to T, chromosome 2 at 69,299,867 bp
  • A to T, chromosome 2 at 111,960,611 bp
  • A to G, chromosome 2 at 112,008,475 bp
  • T to C, chromosome 2 at 120,278,978 bp
  • T to C, chromosome 2 at 121,236,469 bp
  • C to T, chromosome 3 at 96,284,299 bp
  • A to G, chromosome 3 at 98,622,074 bp
  • T to C, chromosome 3 at 101,589,872 bp
  • A to T, chromosome 3 at 129,810,613 bp
  • T to C, chromosome 3 at 138,466,137 bp
  • A to G, chromosome 4 at 41,729,883 bp
  • C to T, chromosome 4 at 43,706,080 bp
  • T to C, chromosome 4 at 46,846,340 bp
  • T to C, chromosome 4 at 140,829,234 bp
  • T to G, chromosome 4 at 141,200,144 bp
  • C to T, chromosome 4 at 145,121,368 bp
  • T to A, chromosome 4 at 148,951,745 bp
  • C to A, chromosome 5 at 44,101,653 bp
  • T to C, chromosome 5 at 105,220,098 bp
  • T to C, chromosome 5 at 113,183,072 bp
  • A to G, chromosome 5 at 140,741,551 bp
  • A to G, chromosome 6 at 34,167,656 bp
  • G to C, chromosome 6 at 72,616,278 bp
  • G to T, chromosome 6 at 134,450,818 bp
  • T to A, chromosome 7 at 5,327,628 bp
  • A to T, chromosome 7 at 8,255,307 bp
  • A to T, chromosome 7 at 19,014,869 bp
  • T to C, chromosome 7 at 50,279,549 bp
  • C to T, chromosome 7 at 62,419,782 bp
  • A to C, chromosome 7 at 108,544,900 bp
  • A to G, chromosome 7 at 109,901,159 bp
  • A to T, chromosome 7 at 118,809,971 bp
  • T to G, chromosome 9 at 21,286,587 bp
  • T to C, chromosome 10 at 61,323,331 bp
  • CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG to CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG, chromosome 10 at 81,321,318 bp
  • A to G, chromosome 10 at 115,403,300 bp
  • T to C, chromosome 11 at 29,225,925 bp
  • G to A, chromosome 11 at 49,341,048 bp
  • T to C, chromosome 11 at 69,589,189 bp
  • G to A, chromosome 11 at 78,272,384 bp
  • A to G, chromosome 11 at 79,240,358 bp
  • T to A, chromosome 11 at 115,346,378 bp
  • A to G, chromosome 12 at 52,517,698 bp
  • A to G, chromosome 12 at 70,458,850 bp
  • C to A, chromosome 12 at 72,136,041 bp
  • T to C, chromosome 12 at 85,857,464 bp
  • A to G, chromosome 12 at 116,414,834 bp
  • A to T, chromosome 13 at 50,247,168 bp
  • A to G, chromosome 13 at 66,963,362 bp
  • G to T, chromosome 13 at 100,316,019 bp
  • A to T, chromosome 14 at 26,872,320 bp
  • A to T, chromosome 14 at 53,363,978 bp
  • T to C, chromosome 14 at 54,961,568 bp
  • G to A, chromosome 16 at 65,545,346 bp
  • CACTTAC to CAC, chromosome 16 at 90,772,573 bp
  • C to T, chromosome 17 at 8,757,028 bp
  • T to A, chromosome 17 at 27,720,245 bp
  • T to C, chromosome 17 at 46,411,247 bp
  • A to T, chromosome 19 at 9,008,165 bp
  • G to A, chromosome 19 at 11,590,073 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7339 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045429-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.