Strain Name:
C57BL/6J-MtgxR7340Btlr/Mmmh
Stock Number:
045430-MU
Citation ID:
RRID:MMRRC_045430-MU
Other Names:
R7340 (G1)
Major Collection:

Strain Information

Dntt
Name: deoxynucleotidyltransferase, terminal
Synonyms: Tdt
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 21673
VEGA: 19
HGNC: HGNC:2983
Homologene: 3014
Itgb8
Name: integrin beta 8
Synonyms: 4832412O06Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320910
HGNC: HGNC:6163
Homologene: 18567
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, Macf2, bullous pemphigoid antigen 1, athetoid, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Taok1
Name: TAO kinase 1
Synonyms: D130018F14Rik, 2810468K05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216965
Homologene: 27041
Camsap3
Name: calmodulin regulated spectrin-associated protein family, member 3
Synonyms: Nezha, 2310057J16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 69697
Homologene: 18966
Ldlrad3
Name: low density lipoprotein receptor class A domain containing 3
Synonyms: Lrad3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241576
Homologene: 18377
Fmn2
Name: formin 2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 54418
Homologene: 137334
Fus
Name: fused in sarcoma
Synonyms: translocated in liposarcoma, Tls, hnRNP P2, pigpen, D930039C12Rik, D430004D17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233908
HGNC: HGNC:4010
Homologene: 134091
Daam1
Name: dishevelled associated activator of morphogenesis 1
Synonyms: 1700066F09Rik, 2310028E21Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 208846
VEGA: 12
Homologene: 36635
Sart3
Name: squamous cell carcinoma antigen recognized by T cells 3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 53890
Homologene: 40977
Srbd1
Name: S1 RNA binding domain 1
Synonyms: D530025C17Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 78586
VEGA: 17
Homologene: 9994
Clec16a
Name: C-type lectin domain family 16, member A
Synonyms: 4932416N17Rik, curt
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74374
Homologene: 71019
Rbm26
Name: RNA binding motif protein 26
Synonyms: Pro1777, C230097K14Rik, 1700009P03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 74213
Homologene: 41468
Gga1
Name: golgi associated, gamma adaptin ear containing, ARF binding protein 1
Synonyms: 4930406E12Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 106039
VEGA: 15
Homologene: 39250
Hk2
Name: hexokinase 2
Synonyms: HKII
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15277
HGNC: HGNC:4923
Homologene: 37273
Sema4d
Name: sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D
Synonyms: semaphorin H, M-sema G, coll-4, CD100, Semcl2, Semaj, Semacl2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20354
Homologene: 21282
Syngr2
Name: synaptogyrin 2
Synonyms: Clast2, cellugyrin
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20973
Homologene: 20987
Slc39a2
Name: solute carrier family 39 (zinc transporter), member 2
Synonyms: zip2, F730005G13Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 214922
Homologene: 40957
Oga
Name: O-GlcNAcase
Synonyms: Hy5, 5830447M11Rik, 4833427O07Rik, 2810009A20Rik, Mgea5
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 76055
VEGA: 19
HGNC: HGNC:7056
Homologene: 8154
Mettl13
Name: methyltransferase 13, eEF1A lysine and N-terminal methyltransferase
Synonyms: 5630401D24Rik, Eef1aknmt
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71449
Homologene: 32285
Galnt9
Name: polypeptide N-acetylgalactosaminyltransferase 9
Synonyms: GalNAc-T9
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231605
HGNC: HGNC:4131
Homologene: 72793
Pole
Name: polymerase (DNA directed), epsilon
Synonyms: pol-epsilon
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18973
HGNC: HGNC:9177
Homologene: 4539
Adam30
Name: a disintegrin and metallopeptidase domain 30
Synonyms: 4933424D07Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71078
HGNC: HGNC:208
Homologene: 11038
Ms4a6d
Name: membrane-spanning 4-domains, subfamily A, member 6D
Synonyms: Ms4a11
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 68774
Homologene: 130755
Per1
Name: period circadian clock 1
Synonyms: m-rigui, mPer1, Hftm
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18626
HGNC: HGNC:8845
Homologene: 1966
Ccdc47
Name: coiled-coil domain containing 47
Synonyms: asp4, 2610204L23Rik, calumin
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67163
Homologene: 41351
Atp4a
Name: ATPase, H+/K+ exchanging, gastric, alpha polypeptide
Synonyms: H+K+-transporting alpha 1, H+/K+-ATPase alpha
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11944
HGNC: HGNC:819
Homologene: 68081
Cdh23
Name: cadherin related 23 (otocadherin)
Synonyms: 4930542A03Rik, USH1D, mdfw, ahl, bob, nmf112, nmf181, nmf252, sals
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22295
Homologene: 11142
Mns1
Name: meiosis-specific nuclear structural protein 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17427
Homologene: 40628
Exosc9
Name: exosome component 9
Synonyms: PM/Scl-75, RRP45, p6, p5, Pmscl1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 50911
HGNC: HGNC:9137
Homologene: 3693
Sec31b
Name: SEC31 homolog B, COPII coat complex component
Synonyms: LOC240667, Sec31l2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240667
Homologene: 56708
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Exph5
Name: exophilin 5
Synonyms: slac2-b, B130009M24Rik, AC079869.22gm5, Slac2b
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320051
Homologene: 9007
Ltbp1
Name: latent transforming growth factor beta binding protein 1
Synonyms: LTBP-1, 9430031G15Rik, b2b1000Clo, Ltbp1L
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268977
HGNC: HGNC:6714
Homologene: 522
Insrr
Name: insulin receptor-related receptor
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 23920
HGNC: HGNC:6093
Homologene: 56539
Cdcp3
Name: CUB domain containing protein 3
Synonyms: 5430419D17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71395
Homologene: 138430
Polq
Name: polymerase (DNA directed), theta
Synonyms: A430110D14Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 77782
HGNC: HGNC:9186
Homologene: 32727
Fbp2
Name: fructose bisphosphatase 2
Synonyms: FBPase muscle, Fbp-1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14120
VEGA: 13
HGNC: HGNC:3607
Homologene: 55784
Tnn
Name: tenascin N
Synonyms: tenascin-W, Tnw
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329278
Homologene: 18634
Zan
Name: zonadhesin
Synonyms: Zan
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22635
Homologene: 124417
Abcb11
Name: ATP-binding cassette, sub-family B member 11
Synonyms: PFIC2, ABC16, PGY4, Lith1, sister of P-glycoprotein, Bsep
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27413
HGNC: HGNC:42
Homologene: 74509
Nlrp12
Name: NLR family, pyrin domain containing 12
Synonyms: Nalp12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 378425
Homologene: 16972
Otoa
Name: otoancorin
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 246190
Homologene: 71803
Igsf10
Name: immunoglobulin superfamily, member 10
Synonyms: 6530405F15Rik, CMF608, Adlican2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242050
Homologene: 18712
Cfap65
Name: cilia and flagella associated protein 65
Synonyms: B230363K08Rik, Ccdc108
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241116
Homologene: 28093
Slc13a3
Name: solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3
Synonyms: SDCT2, NaDC3, NaDC-3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 114644
Homologene: 11266
Phykpl
Name: 5-phosphohydroxy-L-lysine phospholyase
Synonyms: 2900006B13Rik, Agxt2l2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72947
Homologene: 75268
Tcaf3
Name: TRPM8 channel-associated factor 3
Synonyms: Eapa2, Fam115e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 403088
Homologene: 74374
Ccdc178
Name: coiled coil domain containing 178
Synonyms: 4921528I01Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 70950
VEGA: 18
Homologene: 12373
Myo5c
Name: myosin VC
Synonyms: 9130003O20Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208943
VEGA: 9
HGNC: HGNC:7604
Homologene: 135711
Gp1ba
Name: glycoprotein 1b, alpha polypeptide
Synonyms: GP Ib-alpha, GPIb-alpha, GPIba
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14723
HGNC: HGNC:4439
Homologene: 143
Cep89
Name: centrosomal protein 89
Synonyms: 2610507L03Rik, Ccdc123
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72140
Homologene: 12444
AY358078
Name: cDNA sequence AY358078
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 278676
Homologene: 115686
Tmf1
Name: TATA element modulatory factor 1
Synonyms: LOC232286, 7030402D04Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232286
Homologene: 133801
Dsel
Name: dermatan sulfate epimerase-like
Synonyms: 9330132E09Rik, DS-epi2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 319901
Homologene: 12964
Asb15
Name: ankyrin repeat and SOCS box-containing 15
Synonyms: 4930400E23Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 78910
Homologene: 43797
Ip6k3
Name: inositol hexaphosphate kinase 3
Synonyms: D830007E07Rik, Ihpk3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 271424
Homologene: 65257
Cactin
Name: cactin, spliceosome C complex subunit
Synonyms: 2510012J08Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70312
VEGA: 10
Homologene: 69553
Ano8
Name: anoctamin 8
Synonyms: Tmem16h
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382014
Homologene: 124473
Apc2
Name: APC regulator of WNT signaling pathway 2
Synonyms: APCL
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 23805
Homologene: 4299
Sgip1
Name: SH3-domain GRB2-like (endophilin) interacting protein 1
Synonyms: 3110007P09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 73094
Homologene: 13001
Or2t1
Name: olfactory receptor family 2 subfamily T member 1
Synonyms: MTPCR53, MOR274-1, GA_x6K02T2PLTE-6714644-6715597, Olfr31
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18330
HGNC: HGNC:8277
Homologene: 74028
Zc3h6
Name: zinc finger CCCH type containing 6
Synonyms: 4631426G04Rik, 4833425H18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78751
Homologene: 35328
Ttll13
Name: tubulin tyrosine ligase-like family, member 13
Synonyms: 1700111A04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269954
Homologene: 136186
Ccdc62
Name: coiled-coil domain containing 62
Synonyms: LOC208908, G1-485-3, repro29
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 208908
Homologene: 82466
Cables2
Name: CDK5 and Abl enzyme substrate 2
Synonyms: ik3-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 252966
Homologene: 45440
Vmn1r85
Name: vomeronasal 1 receptor 85
Synonyms: V1rj3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 252909
Homologene: 74338
Tas2r106
Name: taste receptor, type 2, member 106
Synonyms: T2R06, Tas2r6, mGR06, mt2r44
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387341
Homologene: 130071
Col25a1
Name: collagen, type XXV, alpha 1
Synonyms: 2700062B08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77018
Homologene: 57111
Polr1g
Name: RNA polymerase I subunit G
Synonyms: PAF49, 2610103M17Rik, Ase1, Cd3eap
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70333
Homologene: 17107
Ankrd55
Name: ankyrin repeat domain 55
Synonyms: C030011J08Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 77318
VEGA: 13
Homologene: 12674
Ryk
Name: receptor-like tyrosine kinase
Synonyms: Vik, ERK-3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20187
Homologene: 68287
Slc2a5
Name: solute carrier family 2 (facilitated glucose transporter), member 5
Synonyms: GLUT5
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56485
Homologene: 74459
Or14j8
Name: olfactory receptor family 14 subfamily J member 8
Synonyms: GA_x6K02T2PSCP-2403971-2403000, MOR218-6P, MOR218-5P, MOR218-6P, MOR218-12, Olfr1552-ps1, Olfr761
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258094
Homologene: 134080
Or14c44
Name: olfactory receptor family 14 subfamily C member 44
Synonyms: GA_x6K02T2NHDJ-9693313-9692378, MOR221-1P, MOR211-8P, MOR221-1P, MOR221-4, Olfr1531-ps1, GA_x6K02T2NHDJ-9695951-9695766, Olfr302, Olfr301
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 257958
Homologene: 128067
Wdr81
Name: WD repeat domain 81
Synonyms: shakey 5, MGC32441, nur5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192652
Homologene: 13983
Sap25
Name: sin3 associated polypeptide
Synonyms: 25 kDa
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 751865
Homologene: 104044
Tmem151b
Name: transmembrane protein 151B
Synonyms: LOC210573
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 210573
VEGA: 17
Homologene: 19365
Cimap1b
Name: ciliary microtubule associated protein 1B
Synonyms: 2010001J22Rik, Odf3b
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70113
VEGA: 15
Homologene: 28256
Mri1
Name: methylthioribose-1-phosphate isomerase 1
Synonyms: 2410018C20Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67873
Homologene: 7160
Phactr3
Name: phosphatase and actin regulator 3
Synonyms: scapinin, 1500003N10Rik, 4930415A02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74189
Homologene: 14482
Or5d39
Name: olfactory receptor family 5 subfamily D member 39
Synonyms: GA_x6K02T2Q125-49641892-49640942, MOR174-16, Olfr1167
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258291
Homologene: 138307
Gdi1
Name: GDP dissociation inhibitor 1
Synonyms: GDIA, Rab GDIalpha
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 14567
HGNC: HGNC:4226
Homologene: 37487
Traj33
Name: T cell receptor alpha joining 33
Synonyms: Gm16666
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100124356
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 34,190,729 bp
  • T to C, chromosome 1 at 74,921,583 bp
  • C to T, chromosome 1 at 111,861,573 bp
  • G to T, chromosome 1 at 160,146,022 bp
  • T to C, chromosome 1 at 162,538,978 bp
  • CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC to CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC, chromosome 1 at 174,609,203 bp
  • C to T, chromosome 2 at 69,299,867 bp
  • T to C, chromosome 2 at 76,884,071 bp
  • T to C, chromosome 2 at 88,149,276 bp
  • T to C, chromosome 2 at 102,066,839 bp
  • A to G, chromosome 2 at 128,993,190 bp
  • T to C, chromosome 2 at 165,430,290 bp
  • G to A, chromosome 2 at 178,334,061 bp
  • A to G, chromosome 2 at 180,261,657 bp
  • A to G, chromosome 3 at 36,561,148 bp
  • A to G, chromosome 3 at 59,325,768 bp
  • G to A, chromosome 3 at 87,814,316 bp
  • A to T, chromosome 3 at 98,162,321 bp
  • A to G, chromosome 3 at 130,546,357 bp
  • G to C, chromosome 4 at 102,921,464 bp
  • A to G, chromosome 4 at 150,139,982 bp
  • A to T, chromosome 5 at 110,334,464 bp
  • T to A, chromosome 5 at 110,614,188 bp
  • A to G, chromosome 5 at 113,744,667 bp
  • A to G, chromosome 5 at 123,951,220 bp
  • T to C, chromosome 5 at 137,383,830 bp
  • A to G, chromosome 5 at 137,642,673 bp
  • T to A, chromosome 6 at 24,558,514 bp
  • A to G, chromosome 6 at 42,589,914 bp
  • T to C, chromosome 6 at 82,728,892 bp
  • T to C, chromosome 6 at 97,168,100 bp
  • T to A, chromosome 6 at 131,678,222 bp
  • T to G, chromosome 7 at 3,233,125 bp
  • T to C, chromosome 7 at 13,085,146 bp
  • T to C, chromosome 7 at 19,359,148 bp
  • T to C, chromosome 7 at 30,716,730 bp
  • G to A, chromosome 7 at 35,429,928 bp
  • G to T, chromosome 7 at 80,257,024 bp
  • T to C, chromosome 7 at 86,412,749 bp
  • A to G, chromosome 7 at 121,130,065 bp
  • T to A, chromosome 7 at 127,981,951 bp
  • A to G, chromosome 7 at 131,277,615 bp
  • G to A, chromosome 8 at 3,587,960 bp
  • T to A, chromosome 8 at 71,483,011 bp
  • C to T, chromosome 8 at 84,256,896 bp
  • G to A, chromosome 9 at 53,377,009 bp
  • A to G, chromosome 9 at 72,448,743 bp
  • A to C, chromosome 9 at 75,289,141 bp
  • T to C, chromosome 9 at 102,898,538 bp
  • A to G, chromosome 10 at 60,530,996 bp
  • A to G, chromosome 10 at 80,313,482 bp
  • CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG to CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG, chromosome 10 at 81,321,318 bp
  • T to C, chromosome 11 at 51,599,543 bp
  • A to G, chromosome 11 at 69,103,182 bp
  • T to C, chromosome 11 at 70,640,293 bp
  • T to C, chromosome 11 at 75,444,699 bp
  • A to G, chromosome 11 at 77,579,817 bp
  • T to C, chromosome 11 at 106,200,973 bp
  • A to G, chromosome 11 at 117,812,496 bp
  • T to G, chromosome 12 at 71,988,939 bp
  • T to C, chromosome 12 at 119,192,204 bp
  • A to T, chromosome 13 at 51,723,562 bp
  • A to T, chromosome 13 at 62,837,247 bp
  • A to T, chromosome 13 at 112,355,963 bp
  • A to T, chromosome 14 at 14,328,401 bp
  • A to G, chromosome 14 at 51,826,259 bp
  • A to T, chromosome 14 at 51,894,203 bp
  • A to G, chromosome 14 at 54,185,405 bp
  • A to T, chromosome 14 at 105,152,540 bp
  • A to G, chromosome 15 at 78,891,451 bp
  • T to A, chromosome 15 at 89,378,407 bp
  • A to G, chromosome 16 at 10,580,963 bp
  • A to G, chromosome 16 at 37,060,926 bp
  • T to A, chromosome 17 at 27,148,530 bp
  • T to A, chromosome 17 at 37,952,522 bp
  • G to T, chromosome 17 at 45,545,269 bp
  • T to A, chromosome 17 at 75,327,228 bp
  • A to T, chromosome 17 at 86,136,354 bp
  • A to T, chromosome 18 at 22,017,461 bp
  • G to A, chromosome 19 at 11,590,073 bp
  • A to C, chromosome 19 at 41,058,565 bp
  • T to C, chromosome 19 at 44,528,722 bp
  • G to A, chromosome 19 at 45,767,456 bp
  • G to A, chromosome X at 74,306,855 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7340 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045430-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.