Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7340Btlr/Mmmh
Stock Number:
045430-MU
Citation ID:
RRID:MMRRC_045430-MU
Other Names:
R7340 (G1)
Major Collection:

Strain Information

Dntt
Name: deoxynucleotidyltransferase, terminal
Synonyms: Tdt
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 21673
VEGA: 19
HGNC: HGNC:2983
Homologene: 3014
Itgb8
Name: integrin beta 8
Synonyms: 4832412O06Rik, D630049N15
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320910
HGNC: HGNC:6163
Homologene: 18567
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Taok1
Name: TAO kinase 1
Synonyms: D130018F14Rik, 2810468K05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216965
Homologene: 27041
Camsap3
Name: calmodulin regulated spectrin-associated protein family, member 3
Synonyms: Nezha, 2310057J16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 69697
Homologene: 18966
Ldlrad3
Name: low density lipoprotein receptor class A domain containing 3
Synonyms: Lrad3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241576
Homologene: 18377
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 34,190,729 bp
  • T to C, chromosome 1 at 74,921,583 bp
  • C to T, chromosome 1 at 111,861,573 bp
  • G to T, chromosome 1 at 160,146,022 bp
  • T to C, chromosome 1 at 162,538,978 bp
  • CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC to CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC, chromosome 1 at 174,609,203 bp
  • C to T, chromosome 2 at 69,299,867 bp
  • T to C, chromosome 2 at 76,884,071 bp
  • T to C, chromosome 2 at 88,149,276 bp
  • T to C, chromosome 2 at 102,066,839 bp
  • A to G, chromosome 2 at 128,993,190 bp
  • T to C, chromosome 2 at 165,430,290 bp
  • G to A, chromosome 2 at 178,334,061 bp
  • A to G, chromosome 2 at 180,261,657 bp
  • A to G, chromosome 3 at 36,561,148 bp
  • A to G, chromosome 3 at 59,325,768 bp
  • G to A, chromosome 3 at 87,814,316 bp
  • A to T, chromosome 3 at 98,162,321 bp
  • A to G, chromosome 3 at 130,546,357 bp
  • G to C, chromosome 4 at 102,921,464 bp
  • A to G, chromosome 4 at 150,139,982 bp
  • A to T, chromosome 5 at 110,334,464 bp
  • T to A, chromosome 5 at 110,614,188 bp
  • A to G, chromosome 5 at 113,744,667 bp
  • A to G, chromosome 5 at 123,951,220 bp
  • T to C, chromosome 5 at 137,383,830 bp
  • A to G, chromosome 5 at 137,642,673 bp
  • T to A, chromosome 6 at 24,558,514 bp
  • A to G, chromosome 6 at 42,589,914 bp
  • T to C, chromosome 6 at 82,728,892 bp
  • T to C, chromosome 6 at 97,168,100 bp
  • T to A, chromosome 6 at 131,678,222 bp
  • T to G, chromosome 7 at 3,233,125 bp
  • T to C, chromosome 7 at 13,085,146 bp
  • T to C, chromosome 7 at 19,359,148 bp
  • T to C, chromosome 7 at 30,716,730 bp
  • G to A, chromosome 7 at 35,429,928 bp
  • G to T, chromosome 7 at 80,257,024 bp
  • T to C, chromosome 7 at 86,412,749 bp
  • A to G, chromosome 7 at 121,130,065 bp
  • T to A, chromosome 7 at 127,981,951 bp
  • A to G, chromosome 7 at 131,277,615 bp
  • G to A, chromosome 8 at 3,587,960 bp
  • T to A, chromosome 8 at 71,483,011 bp
  • C to T, chromosome 8 at 84,256,896 bp
  • G to A, chromosome 9 at 53,377,009 bp
  • A to G, chromosome 9 at 72,448,743 bp
  • A to C, chromosome 9 at 75,289,141 bp
  • T to C, chromosome 9 at 102,898,538 bp
  • A to G, chromosome 10 at 60,530,996 bp
  • A to G, chromosome 10 at 80,313,482 bp
  • CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG to CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG, chromosome 10 at 81,321,318 bp
  • T to C, chromosome 11 at 51,599,543 bp
  • A to G, chromosome 11 at 69,103,182 bp
  • T to C, chromosome 11 at 70,640,293 bp
  • T to C, chromosome 11 at 75,444,699 bp
  • A to G, chromosome 11 at 77,579,817 bp
  • T to C, chromosome 11 at 106,200,973 bp
  • A to G, chromosome 11 at 117,812,496 bp
  • T to G, chromosome 12 at 71,988,939 bp
  • T to C, chromosome 12 at 119,192,204 bp
  • A to T, chromosome 13 at 51,723,562 bp
  • A to T, chromosome 13 at 62,837,247 bp
  • A to T, chromosome 13 at 112,355,963 bp
  • A to T, chromosome 14 at 14,328,401 bp
  • A to G, chromosome 14 at 51,826,259 bp
  • A to T, chromosome 14 at 51,894,203 bp
  • A to G, chromosome 14 at 54,185,405 bp
  • A to T, chromosome 14 at 105,152,540 bp
  • A to G, chromosome 15 at 78,891,451 bp
  • T to A, chromosome 15 at 89,378,407 bp
  • A to G, chromosome 16 at 10,580,963 bp
  • A to G, chromosome 16 at 37,060,926 bp
  • T to A, chromosome 17 at 27,148,530 bp
  • T to A, chromosome 17 at 37,952,522 bp
  • G to T, chromosome 17 at 45,545,269 bp
  • T to A, chromosome 17 at 75,327,228 bp
  • A to T, chromosome 17 at 86,136,354 bp
  • A to T, chromosome 18 at 22,017,461 bp
  • G to A, chromosome 19 at 11,590,073 bp
  • A to C, chromosome 19 at 41,058,565 bp
  • T to C, chromosome 19 at 44,528,722 bp
  • G to A, chromosome 19 at 45,767,456 bp
  • G to A, chromosome X at 74,306,855 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7340 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045430-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.