Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7351Btlr/Mmmh
Stock Number:
045437-MU
Citation ID:
RRID:MMRRC_045437-MU
Other Names:
R7351 (G1)
Major Collection:

Strain Information

Rnf145
Name: ring finger protein 145
Synonyms: 3732413I11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74315
Homologene: 14427
Trmo
Name: tRNA methyltransferase O
Synonyms: 5830415F09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74753
Homologene: 32316
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Rnf38
Name: ring finger protein 38
Synonyms: Oip1, 1700065B19Rik, 2610202O07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 73469
Homologene: 32550
Gpr26
Name: G protein-coupled receptor 26
Synonyms: 9630036A11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233919
HGNC: HGNC:4481
Homologene: 17764
Ddx42
Name: DEAD box helicase 42
Synonyms: B430002H05Rik, 1810047H21Rik, SF3b125, DEAD (Asp-Glu-Ala-Asp) box polypeptide 42
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72047
Homologene: 49137
Usp15
Name: ubiquitin specific peptidase 15
Synonyms: Gcap18, 4921514G19Rik, E430033I05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14479
VEGA: 10
Homologene: 101542
Brk1
Name: BRICK1, SCAR/WAVE actin-nucleating complex subunit
Synonyms: 6720456B07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101314
Homologene: 10210
Rbm28
Name: RNA binding motif protein 28
Synonyms: 2810480G15Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68272
Homologene: 135952
Plcg2
Name: phospholipase C, gamma 2
Synonyms: Plcg-2, PLCgamma2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234779
HGNC: HGNC:9066
Homologene: 55671
Zfp866
Name: zinc finger protein 866
Synonyms: 9830167H18Rik, D330038O06Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 330788
Ahi1
Name: Abelson helper integration site 1
Synonyms: Ahi-1, 1700015F03Rik, D10Bwg0629e, Jouberin
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 52906
VEGA: 10
Homologene: 9762
Bicc1
Name: BicC family RNA binding protein 1
Synonyms: Bic-C, jcpk
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 83675
Homologene: 12856
Spg11
Name: SPG11, spatacsin vesicle trafficking associated
Synonyms: C530005A01Rik, 6030465E24Rik, spastic paraplegia 11
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 214585
Homologene: 41614
Spag9
Name: sperm associated antigen 9
Synonyms: 4733401I23Rik, syd1, 4831406C20Rik, Mapk8ip4, JIP4, 3110018C07Rik, JLP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70834
Homologene: 2954
Taf1c
Name: TATA-box binding protein associated factor, RNA polymerase I, C
Synonyms: mTAFI95
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 21341
Homologene: 21163
Zfp592
Name: zinc finger protein 592
Synonyms: A730014M16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233410
Homologene: 8759
Clec12b
Name: C-type lectin domain family 12, member B
Synonyms: 4933425B16Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71183
Homologene: 19247
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: DHC1b, DHC2, 4432416O06Rik, D330044F14Rik, D030010H02Rik, Dnchc2, b2b414Clo, m407Asp, m152Asp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
Pwwp2a
Name: PWWP domain containing 2A
Synonyms: D930040F23Rik, 4631424J17Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70802
Homologene: 19687
Serpina10
Name: serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10
Synonyms: PZI
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217847
Homologene: 9414
Ift172
Name: intraflagellar transport 172
Synonyms: wim, 4930553F24Rik, avc1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 67661
Homologene: 15202
Pierce1
Name: piercer of microtubule wall 1
Synonyms: 1700007K13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69327
Homologene: 35416
Adamts6
Name: ADAM metallopeptidase with thrombospondin type 1 motif 6
Synonyms: ADAM-TS6, A930019D11Rik, b2b2228Clo, b2b2187.1Clo, b2b2182Clo, b2b2029Clo, b2b1879.1Clo
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 108154
VEGA: 13
HGNC: HGNC:222
Homologene: 82573
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545370
Homologene: 23741
Psd
Name: pleckstrin and Sec7 domain containing
Synonyms: Efa6, 1110007H17Rik, Psdl, Efa6a
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 73728
VEGA: 19
HGNC: HGNC:9507
Homologene: 31115
Drc7
Name: dynein regulatory complex subunit 7
Synonyms: LOC330830, SRG-L, Ccdc135
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 330830
Homologene: 12996
Stx18
Name: syntaxin 18
Synonyms: 4933425D03Rik, 1810035L21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71116
Homologene: 9655
Vwa3a
Name: von Willebrand factor A domain containing 3A
Synonyms: E030013G06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233813
Homologene: 18607
Gml2
Name: glycosylphosphatidylinositol anchored molecule like 2
Synonyms: HemT, hematopoietic cell-specific transcript, 1700057K19Rik, Hemt1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 15202
HGNC: HGNC:4375
Homologene: 48071
Ccdc180
Name: coiled-coil domain containing 180
Synonyms: LOC381522, E230008N13Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381522
Homologene: 117988
Or5m10b
Name: olfactory receptor family 5 subfamily M member 10B
Synonyms: GA_x6K02T2Q125-47347069-47348016, MOR196-1, Olfr1022
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258582
Homologene: 128086
Ripk2
Name: receptor (TNFRSF)-interacting serine-threonine kinase 2
Synonyms: CCK, CARDIAK, RIP2, RICK, CARD3, D4Bwg0615e, 2210420D18Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 192656
Homologene: 37856
Sspo
Name: SCO-spondin
Synonyms: C79529, Scospondin
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243369
Homologene: 45453
Tas2r126
Name: taste receptor, type 2, member 126
Synonyms: Tas2r26, mGR26, T2R12, mt2r35, T2R26
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387353
Homologene: 16412
Gmip
Name: Gem-interacting protein
Synonyms: 5031419I10Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 78816
Homologene: 9570
Samd9l
Name: sterile alpha motif domain containing 9-like
Synonyms: ESTM25
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 209086
HGNC: HGNC:1349
Homologene: 7707
Vmn2r89
Name: vomeronasal 2, receptor 89
Synonyms: V2r11, V2r10
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 22301
Matn2
Name: matrilin 2
Synonyms: Crtm2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17181
VEGA: 15
HGNC: HGNC:6908
Homologene: 20538
Sec14l3
Name: SEC14-like lipid binding 3
Synonyms: 1110069O07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380683
Homologene: 24848
Tmc8
Name: transmembrane channel-like gene family 8
Synonyms: EVIN2, Ever2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217356
Homologene: 45126
Irgm2
Name: immunity-related GTPase family M member 2
Synonyms: Gtpi, Iigp2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 54396
Homologene: 78363
Cenpo
Name: centromere protein O
Synonyms: D12Ertd482e, 8430427C03Rik, 2810429O05Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 52504
Homologene: 49760
Or10ak16
Name: olfactory receptor family 10 subfamily AK member 16
Synonyms: GA_x6K02T2QD9B-18644371-18643424, MOR259-8, Olfr1330
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 258331
Homologene: 121524
Slc16a8
Name: solute carrier family 16 (monocarboxylic acid transporters), member 8
Synonyms: proton-coupled monocarboxylate transporter 3, Mct3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 57274
Homologene: 75006
Or4a73
Name: olfactory receptor family 4 subfamily A member 73
Synonyms: GA_x6K02T2Q125-51034790-51033846, MOR231-9, Olfr1246
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258788
Homologene: 74246
Arhgef37
Name: Rho guanine nucleotide exchange factor 37
Synonyms: 4933429F08Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 328967
VEGA: 18
Homologene: 28467
Or8b3
Name: olfactory receptor family 8 subfamily B member 3
Synonyms: M3, GA_x6K02T2PVTD-32098059-32099003, MOR164-1, Olfr147
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258869
VEGA: 9
Homologene: 128279
Mxd1
Name: MAX dimerization protein 1
Synonyms: Mad, Mad1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17119
HGNC: HGNC:6761
Homologene: 1767
H2-Q4
Name: histocompatibility 2, Q region locus 4
Synonyms: Qb-1, Qat-4, Qb1, Qa4, Qa-4, H-2Q4, H2-Gs10
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15015
Homologene: 128352
Cfap97d1
Name: CFAP97 domain containing 1
Synonyms: 1700006E09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 75437
Homologene: 19137
Tdpoz2
Name: TD and POZ domain containing 2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 399673
Homologene: 133956
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 150,667,889 bp
  • TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC to TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC, chromosome 2 at 28,466,110 bp
  • C to T, chromosome 2 at 69,448,142 bp
  • C to T, chromosome 2 at 76,767,686 bp
  • G to A, chromosome 2 at 76,939,930 bp
  • G to T, chromosome 2 at 85,864,071 bp
  • T to A, chromosome 2 at 87,510,328 bp
  • C to T, chromosome 2 at 89,590,513 bp
  • A to G, chromosome 2 at 122,069,931 bp
  • C to T, chromosome 3 at 93,652,593 bp
  • C to A, chromosome 3 at 124,412,510 bp
  • T to G, chromosome 4 at 16,155,048 bp
  • T to C, chromosome 4 at 44,149,102 bp
  • A to G, chromosome 4 at 45,903,887 bp
  • A to T, chromosome 4 at 46,387,716 bp
  • T to C, chromosome 4 at 118,893,836 bp
  • A to G, chromosome 4 at 126,816,444 bp
  • A to G, chromosome 5 at 31,275,896 bp
  • T to A, chromosome 5 at 38,039,411 bp
  • G to A, chromosome 6 at 3,374,157 bp
  • T to C, chromosome 6 at 29,158,880 bp
  • T to C, chromosome 6 at 42,435,306 bp
  • T to C, chromosome 6 at 48,464,921 bp
  • A to G, chromosome 6 at 86,651,466 bp
  • T to C, chromosome 6 at 113,615,781 bp
  • A to G, chromosome 6 at 129,379,911 bp
  • T to C, chromosome 7 at 81,041,691 bp
  • T to A, chromosome 7 at 120,776,336 bp
  • T to C, chromosome 7 at 131,974,365 bp
  • A to T, chromosome 8 at 69,765,897 bp
  • A to G, chromosome 8 at 69,817,384 bp
  • A to G, chromosome 8 at 95,058,507 bp
  • A to G, chromosome 8 at 117,590,310 bp
  • A to G, chromosome 8 at 119,599,000 bp
  • A to T, chromosome 9 at 7,167,145 bp
  • C to T, chromosome 9 at 38,403,443 bp
  • A to G, chromosome 10 at 20,965,933 bp
  • G to T, chromosome 10 at 70,947,900 bp
  • A to T, chromosome 10 at 123,132,999 bp
  • A to G, chromosome 11 at 4,074,785 bp
  • A to G, chromosome 11 at 43,682,280 bp
  • G to A, chromosome 11 at 44,548,796 bp
  • G to A, chromosome 11 at 58,219,605 bp
  • A to T, chromosome 11 at 94,092,976 bp
  • A to G, chromosome 11 at 101,991,505 bp
  • A to G, chromosome 11 at 106,247,682 bp
  • T to C, chromosome 11 at 117,783,828 bp
  • A to T, chromosome 12 at 4,216,581 bp
  • A to T, chromosome 12 at 103,628,935 bp
  • G to A, chromosome 13 at 104,390,112 bp
  • A to G, chromosome 14 at 51,456,282 bp
  • G to A, chromosome 15 at 34,345,336 bp
  • T to C, chromosome 15 at 74,821,376 bp
  • T to A, chromosome 15 at 79,253,641 bp
  • A to G, chromosome 17 at 35,382,878 bp
  • T to A, chromosome 18 at 61,498,215 bp
  • G to T, chromosome 19 at 46,322,430 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7351 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045437-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.