Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7379Btlr/Mmmh
Stock Number:
045461-MU
Citation ID:
RRID:MMRRC_045461-MU
Other Names:
R7379 (G1)
Major Collection:

Strain Information

Kit
Name: KIT proto-oncogene receptor tyrosine kinase
Synonyms: Steel Factor Receptor, c-KIT, Dominant white spotting, belly-spot, Tr-kit, SOW3, SCO5, SCO1, Gsfsow3, Gsfsco5, Gsfsco1, CD117
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16590
HGNC: HGNC:6342
Homologene: 187
Sptbn1
Name: spectrin beta, non-erythrocytic 1
Synonyms: beta fodrin, Spnb-2, spectrin G, brain spectrin, elf3, elf1, 9930031C03Rik, non-erythrocytic, Spnb2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20742
Homologene: 2354
Prdm16
Name: PR domain containing 16
Synonyms: Mel1, 5730557K01Rik, line 27, csp1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70673
Homologene: 11139
Shc1
Name: src homology 2 domain-containing transforming protein C1
Synonyms: p66, ShcA, p66shc
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20416
Homologene: 7934
Gaa
Name: glucosidase, alpha, acid
Synonyms: E430018M07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14387
HGNC: HGNC:4065
Homologene: 37268
Rngtt
Name: RNA guanylyltransferase and 5'-phosphatase
Synonyms: mouse capping enzyme
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 24018
Homologene: 37851
Ankrd12
Name: ankyrin repeat domain 12
Synonyms: ANCO-2, GAC-1, 2900001A12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106585
Homologene: 9059
Thoc1
Name: THO complex 1
Synonyms: 3110002N20Rik, NMP-84
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225160
VEGA: 18
Homologene: 38012
Esf1
Name: ESF1 nucleolar pre-rRNA processing protein homolog
Synonyms: 2610101J03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66580
Homologene: 5717
Ift122
Name: intraflagellar transport 122
Synonyms: C86139, Wdr10, sopb
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 81896
Homologene: 12819
Sptb
Name: spectrin beta, erythrocytic
Synonyms: Spnb-1, spectrin R, D330027P03Rik, LOC383567, brain erythroid spectrin (235E), Spnb1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20741
Homologene: 295
Flrt2
Name: fibronectin leucine rich transmembrane protein 2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 399558
HGNC: HGNC:3761
Homologene: 8291
Notch1
Name: notch 1
Synonyms: lin-12, Tan1, Mis6, 9930111A19Rik, Motch A, N1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18128
HGNC: HGNC:7881
Homologene: 32049
Slc25a38
Name: solute carrier family 25, member 38
Synonyms: appoptosin
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208638
Homologene: 5553
Itpkc
Name: inositol 1,4,5-trisphosphate 3-kinase C
Synonyms: 9130023N17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233011
Homologene: 11868
Map1s
Name: microtubule-associated protein 1S
Synonyms: VCY2IP1, 6430517J16Rik, Bpy2ip1, Map8, Mtap1s
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270058
Homologene: 10047
Trpm2
Name: transient receptor potential cation channel, subfamily M, member 2
Synonyms: Trrp7, LTRPC2, TRPC7, 9830168K16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 28240
Homologene: 20709
Mturn
Name: maturin, neural progenitor differentiation regulator homolog (Xenopus)
Synonyms: B230212L03Rik, 2410066E13Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68235
H2-T22
Name: histocompatibility 2, T region locus 22
Synonyms: H-2T22, H-2T17, H2-T17
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15039
Homologene: 79525
Usf3
Name: upstream transcription factor family member 3
Synonyms: LOC207806, LOC385650, 5530400K22Rik, Gm608
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207806
Homologene: 19504
Cyp7b1
Name: cytochrome P450, family 7, subfamily b, polypeptide 1
Synonyms: hct-1, D3Ertd552e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 13123
HGNC: HGNC:2652
Homologene: 3544
Plb1
Name: phospholipase B1
Synonyms: 4632413E21Rik, 4930433E17Rik, 4930539A06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 665270
Homologene: 82108
Wdfy4
Name: WD repeat and FYVE domain containing 4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 545030
Homologene: 83473
Plcb1
Name: phospholipase C, beta 1
Synonyms: 3110043I21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18795
Homologene: 22876
Stx2
Name: syntaxin 2
Synonyms: Epim, G1-536-1, repro34, Syn-2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13852
HGNC: HGNC:3403
Homologene: 37559
L3mbtl1
Name: L3MBTL1 histone methyl-lysine binding protein
Synonyms: L3MBTL1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241764
Homologene: 41846
Serpinb10
Name: serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 10
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241197
HGNC: HGNC:8942
Homologene: 68430
Cyp2j6
Name: cytochrome P450, family 2, subfamily j, polypeptide 6
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13110
HGNC: HGNC:2634
Homologene: 68091
Mug2
Name: murinoglobulin 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17837
HGNC: HGNC:9750
Homologene: 136663
Or9s14
Name: olfactory receptor family 9 subfamily S member 14
Synonyms: GA_x6K02T2R7CC-81146179-81145211, MOR208-2, Olfr1410
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 258484
Homologene: 74205
Slc6a13
Name: solute carrier family 6 (neurotransmitter transporter, GABA), member 13
Synonyms: Gabt3, Gat2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14412
Homologene: 9592
Ccdc149
Name: coiled-coil domain containing 149
Synonyms: LOC242997, Gm447
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100503884
Homologene: 65264
Krt77
Name: keratin 77
Synonyms: 4732484G22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 406220
Homologene: 45490
Or10g1
Name: olfactory receptor family 10 subfamily G member 1
Synonyms: GA_x6K02T2RJGY-583652-584608, MOR223-6, Olfr1510, MOR29A
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258423
HGNC: HGNC:8170
Homologene: 87788
Hexb
Name: hexosaminidase B
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15212
VEGA: 13
HGNC: HGNC:4879
Homologene: 437
Stpg4
Name: sperm tail PG rich repeat containing 4
Synonyms: 1700011E24Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 75467
Homologene: 18339
Sorcs3
Name: sortilin-related VPS10 domain containing receptor 3
Synonyms: 6330404A12Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66673
VEGA: 19
Homologene: 8986
Vmn2r106
Name: vomeronasal 2, receptor 106
Synonyms: EG224576
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224576
Homologene: 135824
Zeb2
Name: zinc finger E-box binding homeobox 2
Synonyms: SIP1, Zfx1b, 9130203F04Rik, D130016B08Rik, Zfhx1b
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 24136
Homologene: 8868
Ctu1
Name: cytosolic thiouridylase subunit 1
Synonyms: Atpbd3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233189
Homologene: 102140
Ift57
Name: intraflagellar transport 57
Synonyms: MHS4R2, HIPPI, 4833420A15Rik, Esrrbl1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 73916
Homologene: 32383
Or4c12b
Name: olfactory receptor family 4 subfamily C member 12B
Synonyms: GA_x6K02T2Q125-51257221-51258135, MOR232-4, Olfr1255
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258979
Homologene: 82298
Cyp4a14
Name: cytochrome P450, family 4, subfamily a, polypeptide 14
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13119
Homologene: 134697
Or12e13
Name: olfactory receptor family 12 subfamily E member 13
Synonyms: GA_x6K02T2Q125-49334566-49335510, MOR264-7, Olfr1148
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258220
Homologene: 79465
Klf1
Name: Kruppel-like transcription factor 1 (erythroid)
Synonyms: Eklf, Nan
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16596
HGNC: HGNC:6345
Homologene: 4785
Pcdhga10
Name: protocadherin gamma subfamily A, 10
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93722
HGNC: HGNC:8697
Homologene: 49567
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 92,608,467 bp
  • T to C, chromosome 1 at 107,532,387 bp
  • A to G, chromosome 2 at 26,479,467 bp
  • G to T, chromosome 2 at 45,001,817 bp
  • T to A, chromosome 2 at 87,833,779 bp
  • T to A, chromosome 2 at 89,816,689 bp
  • A to G, chromosome 2 at 135,370,510 bp
  • A to G, chromosome 2 at 140,154,934 bp
  • T to A, chromosome 2 at 162,960,979 bp
  • A to G, chromosome 3 at 18,097,374 bp
  • T to C, chromosome 3 at 89,426,822 bp
  • A to T, chromosome 4 at 33,498,981 bp
  • T to C, chromosome 4 at 96,525,946 bp
  • A to T, chromosome 4 at 115,493,710 bp
  • T to A, chromosome 4 at 154,528,859 bp
  • A to G, chromosome 5 at 32,345,639 bp
  • A to G, chromosome 5 at 52,405,066 bp
  • A to T, chromosome 5 at 75,647,752 bp
  • A to G, chromosome 5 at 128,987,799 bp
  • A to G, chromosome 6 at 54,689,084 bp
  • C to T, chromosome 6 at 115,926,302 bp
  • A to T, chromosome 6 at 121,336,839 bp
  • A to G, chromosome 6 at 122,047,487 bp
  • A to T, chromosome 7 at 27,227,769 bp
  • AGGACCGGGCAGGAGCCACCTGTGTATCGCAGAGGGACCTGAGCCTTGGGAATGGAGGGGACCGGGCAGGAGCCACCTGTGTATCGCAG to AGGACCGGGCAGGAGCCACCTGTGTATCGCAG, chromosome 7 at 43,677,066 bp
  • A to G, chromosome 8 at 70,913,575 bp
  • T to A, chromosome 8 at 84,903,217 bp
  • C to A, chromosome 9 at 110,839,193 bp
  • T to A, chromosome 9 at 120,120,836 bp
  • T to C, chromosome 10 at 77,914,734 bp
  • T to C, chromosome 11 at 30,139,292 bp
  • T to C, chromosome 11 at 119,283,699 bp
  • A to T, chromosome 12 at 76,610,877 bp
  • G to A, chromosome 12 at 95,780,555 bp
  • A to G, chromosome 13 at 97,181,164 bp
  • A to G, chromosome 14 at 33,151,609 bp
  • T to C, chromosome 14 at 52,410,261 bp
  • T to C, chromosome 15 at 101,861,274 bp
  • T to A, chromosome 16 at 44,220,576 bp
  • A to G, chromosome 16 at 49,760,994 bp
  • C to T, chromosome 17 at 20,267,775 bp
  • A to G, chromosome 17 at 36,042,340 bp
  • G to A, chromosome 17 at 65,985,247 bp
  • T to A, chromosome 17 at 87,427,640 bp
  • A to T, chromosome 18 at 9,992,902 bp
  • A to G, chromosome 18 at 37,747,566 bp
  • T to C, chromosome 19 at 48,772,266 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7379 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045461-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.