Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7411Btlr/Mmmh
Stock Number:
045492-MU
Citation ID:
RRID:MMRRC_045492-MU
Other Names:
R7411 (G1)
Major Collection:

Strain Information

Nos2
Name: nitric oxide synthase 2, inducible
Synonyms: iNOS, Nos-2, NOS-II, Nos2a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18126
HGNC: HGNC:7873
Homologene: 55473
Pitpnc1
Name: phosphatidylinositol transfer protein, cytoplasmic 1
Synonyms: C330017I21Rik, 5830436L09Rik, 1110020B03Rik, RDGB-BETA, RDGBB1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71795
Homologene: 138301
Abcc8
Name: ATP-binding cassette, sub-family C member 8
Synonyms: SUR1, Sur, D930031B21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20927
HGNC: HGNC:59
Homologene: 68048
Armh3
Name: armadillo-like helical domain containing 3
Synonyms: 9130011E15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 71617
VEGA: 19
Homologene: 15843
Vps13c
Name: vacuolar protein sorting 13C
Synonyms: C230055H22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320528
VEGA: 9
Homologene: 41188
Ccdc91
Name: coiled-coil domain containing 91
Synonyms: 1700086G08Rik, 1810060J02Rik, p56
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67015
Homologene: 10131
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 34,472,192 bp
  • A to C, chromosome 1 at 58,988,518 bp
  • A to T, chromosome 1 at 86,350,842 bp
  • G to A, chromosome 1 at 132,417,666 bp
  • A to G, chromosome 2 at 30,066,885 bp
  • C to T, chromosome 2 at 69,303,936 bp
  • T to C, chromosome 2 at 89,881,261 bp
  • A to G, chromosome 2 at 181,686,664 bp
  • C to A, chromosome 2 at 181,815,106 bp
  • A to T, chromosome 3 at 15,542,997 bp
  • A to G, chromosome 3 at 144,802,099 bp
  • A to G, chromosome 3 at 146,097,145 bp
  • G to A, chromosome 4 at 123,829,642 bp
  • T to C, chromosome 4 at 129,551,970 bp
  • T to A, chromosome 4 at 152,554,717 bp
  • T to A, chromosome 5 at 11,183,149 bp
  • T to G, chromosome 5 at 13,516,263 bp
  • A to T, chromosome 5 at 16,824,765 bp
  • T to C, chromosome 5 at 72,122,195 bp
  • C to T, chromosome 5 at 130,152,424 bp
  • G to C, chromosome 5 at 136,697,971 bp
  • C to T, chromosome 5 at 139,764,260 bp
  • T to C, chromosome 6 at 34,814,819 bp
  • T to A, chromosome 6 at 64,729,930 bp
  • T to C, chromosome 6 at 113,056,111 bp
  • T to A, chromosome 6 at 120,426,815 bp
  • T to A, chromosome 6 at 123,232,186 bp
  • C to T, chromosome 6 at 147,592,198 bp
  • T to A, chromosome 7 at 17,750,753 bp
  • A to G, chromosome 7 at 43,826,943 bp
  • A to G, chromosome 7 at 44,878,243 bp
  • A to G, chromosome 7 at 46,165,917 bp
  • A to T, chromosome 7 at 81,092,852 bp
  • CGGC to CGGCGGCGGGGGC, chromosome 7 at 97,579,932 bp
  • CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,817 bp
  • G to T, chromosome 8 at 25,892,088 bp
  • C to A, chromosome 8 at 86,560,850 bp
  • A to T, chromosome 8 at 109,513,871 bp
  • T to C, chromosome 8 at 113,777,730 bp
  • CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC to CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC, chromosome 8 at 126,389,038 bp
  • T to C, chromosome 9 at 36,475,684 bp
  • T to A, chromosome 9 at 67,972,001 bp
  • A to G, chromosome 9 at 123,604,948 bp
  • T to A, chromosome 10 at 92,868,755 bp
  • T to A, chromosome 11 at 5,718,116 bp
  • A to T, chromosome 11 at 49,148,994 bp
  • A to G, chromosome 11 at 59,185,985 bp
  • A to G, chromosome 11 at 62,605,908 bp
  • G to A, chromosome 11 at 68,386,089 bp
  • G to A, chromosome 11 at 78,944,855 bp
  • G to T, chromosome 11 at 96,822,183 bp
  • T to G, chromosome 11 at 104,999,723 bp
  • A to G, chromosome 11 at 107,212,572 bp
  • T to C, chromosome 13 at 27,318,142 bp
  • T to A, chromosome 13 at 72,629,063 bp
  • T to C, chromosome 13 at 100,818,180 bp
  • A to G, chromosome 14 at 30,352,990 bp
  • A to C, chromosome 14 at 33,106,131 bp
  • A to T, chromosome 14 at 52,178,051 bp
  • C to T, chromosome 14 at 68,626,947 bp
  • C to T, chromosome 15 at 74,707,199 bp
  • T to C, chromosome 16 at 32,751,322 bp
  • A to G, chromosome 17 at 24,328,569 bp
  • A to G, chromosome 17 at 44,081,475 bp
  • G to A, chromosome 17 at 72,846,444 bp
  • A to G, chromosome 18 at 11,840,515 bp
  • G to T, chromosome 18 at 36,953,058 bp
  • A to G, chromosome 18 at 37,021,608 bp
  • A to T, chromosome 18 at 57,941,013 bp
  • C to T, chromosome 19 at 3,717,241 bp
  • A to C, chromosome 19 at 45,965,435 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7411 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045492-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.