Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7411Btlr/Mmmh
Stock Number:
045492-MU
Citation ID:
RRID:MMRRC_045492-MU
Other Names:
R7411 (G1)
Major Collection:

Strain Information

Nos2
Name: nitric oxide synthase 2, inducible
Synonyms: iNOS, Nos-2, NOS-II, Nos2a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18126
HGNC: HGNC:7873
Homologene: 55473
Pitpnc1
Name: phosphatidylinositol transfer protein, cytoplasmic 1
Synonyms: C330017I21Rik, 5830436L09Rik, 1110020B03Rik, RDGB-BETA, RDGBB1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71795
Homologene: 138301
Abcc8
Name: ATP-binding cassette, sub-family C member 8
Synonyms: SUR1, Sur, D930031B21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20927
HGNC: HGNC:59
Homologene: 68048
Armh3
Name: armadillo-like helical domain containing 3
Synonyms: 9130011E15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 71617
VEGA: 19
Homologene: 15843
Vps13c
Name: vacuolar protein sorting 13C
Synonyms: C230055H22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320528
VEGA: 9
Homologene: 41188
Ccdc91
Name: coiled-coil domain containing 91
Synonyms: 1700086G08Rik, 1810060J02Rik, p56
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67015
Homologene: 10131
Ints1
Name: integrator complex subunit 1
Synonyms: 1110015K06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68510
Homologene: 53111
Kdm5a
Name: lysine demethylase 5A
Synonyms: RBP2, Rbbp2, Jarid1a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 214899
HGNC: HGNC:9886
Homologene: 3419
Med25
Name: mediator complex subunit 25
Synonyms: ESTM2, 2610529E18Rik, 2610034E13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75613
Homologene: 12614
Set
Name: SET nuclear oncogene
Synonyms: StF-IT-1, 5730420M11Rik, 2610030F17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56086
Homologene: 55707
Slc12a2
Name: solute carrier family 12, member 2
Synonyms: sodium/potassium/chloride cotransporters, mBSC2, Nkcc1, sy-ns
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 20496
VEGA: 18
Homologene: 20283
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Lck
Name: lymphocyte protein tyrosine kinase
Synonyms: Hck-3, p56lck
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16818
HGNC: HGNC:6524
Homologene: 3911
Supt16
Name: SPT16, facilitates chromatin remodeling subunit
Synonyms: Cdc68, Fact140, Spt16, Supt16h
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 114741
VEGA: 14
Homologene: 5207
Slc30a5
Name: solute carrier family 30 (zinc transporter), member 5
Synonyms: Zntl1, ZnT-5, ZTL1, 1810010K08Rik, Znt5
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69048
VEGA: 13
Homologene: 41503
Atoh1
Name: atonal bHLH transcription factor 1
Synonyms: Math1, Hath1, bHLHa14
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11921
HGNC: HGNC:797
Homologene: 31297
Myt1
Name: myelin transcription factor 1
Synonyms: NZF-2b, NZF-2a, Nzf2, Nztf2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17932
HGNC: HGNC:7622
Homologene: 3332
Ntn1
Name: netrin 1
Synonyms: Netrin-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18208
HGNC: HGNC:8029
Homologene: 21008
Abca17
Name: ATP-binding cassette, sub-family A member 17
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381072
Homologene: 86807
Cables1
Name: CDK5 and Abl enzyme substrate 1
Synonyms: interactor-1 with cdk3, ik3-1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 63955
VEGA: 18
Homologene: 11097
Enpp5
Name: ectonucleotide pyrophosphatase/phosphodiesterase 5
Synonyms: D17Abb1e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 83965
Homologene: 23313
Ncl
Name: nucleolin
Synonyms: C23, B530004O11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17975
HGNC: HGNC:7667
Homologene: 136488
Kcnu1
Name: potassium channel, subfamily U, member 1
Synonyms: Slo3, Kcnma3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16532
Homologene: 7392
Muc4
Name: mucin 4
Synonyms: 4933405I11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 140474
HGNC: HGNC:7514
Homologene: 124469
Dnai3
Name: dynein axonemal intermediate chain 3
Synonyms: 4931433A13Rik, IC140, Ida7, Wdr63
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242253
Homologene: 44922
Stradb
Name: STE20-related kinase adaptor beta
Synonyms: PRO1038, D1Ucla2, Als2cr2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227154
Homologene: 10237
Tcea2
Name: transcription elongation factor A (SII), 2
Synonyms: SII-T1, Tceat, S-II-T1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21400
Homologene: 68304
Wdfy4
Name: WD repeat and FYVE domain containing 4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 545030
Homologene: 83473
Cacna1d
Name: calcium channel, voltage-dependent, L type, alpha 1D subunit
Synonyms: D-LTCC, Cchl1a, Cchl1a2, Cacnl1a2, 8430418G19Rik, Cav1.3alpha1, C79217
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12289
VEGA: 14
HGNC: HGNC:1391
Homologene: 578
Gm11639
Name: predicted gene 11639
Synonyms: Gm11639, Efcab15
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 105242472
Pmfbp1
Name: polyamine modulated factor 1 binding protein 1
Synonyms: F77, 1700016D22Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56523
Homologene: 23182
Abcc12
Name: ATP-binding cassette, sub-family C member 12
Synonyms: MRP9, 4930467B22Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244562
Homologene: 57211
Kctd7
Name: potassium channel tetramerisation domain containing 7
Synonyms: 9430010P06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 212919
Homologene: 17687
Prl6a1
Name: prolactin family 6, subfamily a, member 1
Synonyms: PLP-B, Prlpb
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19111
Homologene: 49261
Or2t26
Name: olfactory receptor family 2 subfamily T member 26
Synonyms: GA_x6K02T2QP88-6286247-6285294, MOR277-1, Olfr1395
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258877
Homologene: 105890
Abcb11
Name: ATP-binding cassette, sub-family B member 11
Synonyms: PFIC2, ABC16, PGY4, Lith1, sister of P-glycoprotein, Bsep
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27413
HGNC: HGNC:42
Homologene: 74509
Clca3a2
Name: chloride channel accessory 3A2
Synonyms: Clca2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80797
HGNC: HGNC:2017
Homologene: 77224
Agbl3
Name: ATP/GTP binding protein-like 3
Synonyms: 2900053G10Rik, 6530406M24Rik, 4930431N21Rik, Ccp3, Ccp3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 76223
Homologene: 35330
Ypel5
Name: yippee like 5
Synonyms: CGI-127, 2310076K21Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 383295
VEGA: 17
Homologene: 41097
Sema3a
Name: sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A
Synonyms: SemD, semaphorin III, sema III, collapsin-1, Semad
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20346
Homologene: 31358
Alpk3
Name: alpha-kinase 3
Synonyms: Midori
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 116904
Homologene: 10813
Gabrb1
Name: gamma-aminobutyric acid type A receptor subunit beta 1
Synonyms: Gabrb-1, B230208N19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14400
HGNC: HGNC:4081
Homologene: 20221
Adamts18
Name: ADAM metallopeptidase with thrombospondin type 1 motif 18
Synonyms: E130314N14Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 208936
Homologene: 65241
Dstyk
Name: dual serine/threonine and tyrosine protein kinase
Synonyms: A930019K20Rik, C430014H23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 213452
Homologene: 19711
Thumpd3
Name: THUMP domain containing 3
Synonyms: Gtrosa26as
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14911
Homologene: 7351
Adam28
Name: a disintegrin and metallopeptidase domain 28
Synonyms: Dtgn1, MDC-L, D430033C21Rik, C130072N01Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13522
VEGA: 14
HGNC: HGNC:206
Homologene: 40705
Nfe2l1
Name: nuclear factor, erythroid derived 2,-like 1
Synonyms: TCF-11, NRF1, LCR-F1, TCF11, Lcrf1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18023
HGNC: HGNC:7781
Homologene: 20685
Urgcp
Name: upregulator of cell proliferation
Synonyms: 2010005J08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72046
Homologene: 69243
Nphp4
Name: nephronophthisis 4 (juvenile) homolog (human)
Synonyms: 4930564O18Rik, nmf192
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 260305
Homologene: 9024
Klk6
Name: kallikrein related-peptidase 6
Synonyms: Bssp, protease M, neurosin, Prss9, Klk29, Prss18
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19144
HGNC: HGNC:6367
Homologene: 68279
Sirpb1b
Name: signal-regulatory protein beta 1B
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 668101
Homologene: 82993
Pate11
Name: prostate and testis expressed 11
Synonyms: Gm9513
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 671003
Homologene: 86450
Ceacam5
Name: CEA cell adhesion molecule 5
Synonyms: 1600029H12Rik, Psg30
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 73250
Homologene: 115938
Or4c10b
Name: olfactory receptor family 4 subfamily C member 10B
Synonyms: GA_x6K02T2Q125-51319458-51320387, MOR232-1, Olfr1257
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258984
Homologene: 115501
Irx2
Name: Iroquois homeobox 2
Synonyms: IRX6
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16372
Homologene: 56490
Slc6a20b
Name: solute carrier family 6 (neurotransmitter transporter), member 20B
Synonyms: XT3, Xtrp3, Sit1, Slc6a20
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22599
Homologene: 130652
Ptpn18
Name: protein tyrosine phosphatase, non-receptor type 18
Synonyms: HSCF, FLP1, Ptpk1, PTP-K1, PTP-HSCF
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19253
HGNC: HGNC:9649
Homologene: 74971
1810055G02Rik
Name: RIKEN cDNA 1810055G02 gene
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 72056
VEGA: 19
HGNC: HGNC:1174
Homologene: 11174
Speer1e
Name: spermatogenesis associated glutamate (E)-rich protein 1E
Synonyms: Gm5861
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 545728
Clec4n
Name: C-type lectin domain family 4, member n
Synonyms: dectin-2, Clecsf10, Nkcl
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56620
Homologene: 84615
Slc35f3
Name: solute carrier family 35, member F3
Synonyms: B230375D17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 210027
Homologene: 62481
Cfap54
Name: cilia and flagella associated protein 54
Synonyms: LOC380653, Gm872, 4930485B16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 380654
Homologene: 133438
Myl10
Name: myosin, light chain 10, regulatory
Synonyms: PLRLC-C, PLRLC-B, PLRLC-A, PLRLC, 1700027I08Rik, Mylc2pl
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 59310
Homologene: 69341
Pcdha4
Name: protocadherin alpha 4
Synonyms: Cnr1, Crnr1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12936
HGNC: HGNC:8670
Homologene: 130626
Pcdha12
Name: protocadherin alpha 12
Synonyms: Cnr5, Crnr5, Pcdha13
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 192164
HGNC: HGNC:8667
Homologene: 135870
Cdhr17
Name: cadherin related family member 17
Synonyms: Gm28710
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 102640594
Homologene: 141132
Lrrc75a
Name: leucine rich repeat containing 75A
Synonyms: BC046404, Fam211a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192976
Homologene: 65996
Krtap5-24
Name: keratin associated protein 5-24
Synonyms: Gm40460
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 105244938
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 34,472,192 bp
  • A to C, chromosome 1 at 58,988,518 bp
  • A to T, chromosome 1 at 86,350,842 bp
  • G to A, chromosome 1 at 132,417,666 bp
  • A to G, chromosome 2 at 30,066,885 bp
  • C to T, chromosome 2 at 69,303,936 bp
  • T to C, chromosome 2 at 89,881,261 bp
  • A to G, chromosome 2 at 181,686,664 bp
  • C to A, chromosome 2 at 181,815,106 bp
  • A to T, chromosome 3 at 15,542,997 bp
  • A to G, chromosome 3 at 144,802,099 bp
  • A to G, chromosome 3 at 146,097,145 bp
  • G to A, chromosome 4 at 123,829,642 bp
  • T to C, chromosome 4 at 129,551,970 bp
  • T to A, chromosome 4 at 152,554,717 bp
  • T to A, chromosome 5 at 11,183,149 bp
  • T to G, chromosome 5 at 13,516,263 bp
  • A to T, chromosome 5 at 16,824,765 bp
  • T to C, chromosome 5 at 72,122,195 bp
  • C to T, chromosome 5 at 130,152,424 bp
  • G to C, chromosome 5 at 136,697,971 bp
  • C to T, chromosome 5 at 139,764,260 bp
  • T to C, chromosome 6 at 34,814,819 bp
  • T to A, chromosome 6 at 64,729,930 bp
  • T to C, chromosome 6 at 113,056,111 bp
  • T to A, chromosome 6 at 120,426,815 bp
  • T to A, chromosome 6 at 123,232,186 bp
  • C to T, chromosome 6 at 147,592,198 bp
  • T to A, chromosome 7 at 17,750,753 bp
  • A to G, chromosome 7 at 43,826,943 bp
  • A to G, chromosome 7 at 44,878,243 bp
  • A to G, chromosome 7 at 46,165,917 bp
  • A to T, chromosome 7 at 81,092,852 bp
  • CGGC to CGGCGGCGGGGGC, chromosome 7 at 97,579,932 bp
  • CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,817 bp
  • G to T, chromosome 8 at 25,892,088 bp
  • C to A, chromosome 8 at 86,560,850 bp
  • A to T, chromosome 8 at 109,513,871 bp
  • T to C, chromosome 8 at 113,777,730 bp
  • CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC to CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC, chromosome 8 at 126,389,038 bp
  • T to C, chromosome 9 at 36,475,684 bp
  • T to A, chromosome 9 at 67,972,001 bp
  • A to G, chromosome 9 at 123,604,948 bp
  • T to A, chromosome 10 at 92,868,755 bp
  • T to A, chromosome 11 at 5,718,116 bp
  • A to T, chromosome 11 at 49,148,994 bp
  • A to G, chromosome 11 at 59,185,985 bp
  • A to G, chromosome 11 at 62,605,908 bp
  • G to A, chromosome 11 at 68,386,089 bp
  • G to A, chromosome 11 at 78,944,855 bp
  • G to T, chromosome 11 at 96,822,183 bp
  • T to G, chromosome 11 at 104,999,723 bp
  • A to G, chromosome 11 at 107,212,572 bp
  • T to C, chromosome 13 at 27,318,142 bp
  • T to A, chromosome 13 at 72,629,063 bp
  • T to C, chromosome 13 at 100,818,180 bp
  • A to G, chromosome 14 at 30,352,990 bp
  • A to C, chromosome 14 at 33,106,131 bp
  • A to T, chromosome 14 at 52,178,051 bp
  • C to T, chromosome 14 at 68,626,947 bp
  • C to T, chromosome 15 at 74,707,199 bp
  • T to C, chromosome 16 at 32,751,322 bp
  • A to G, chromosome 17 at 24,328,569 bp
  • A to G, chromosome 17 at 44,081,475 bp
  • G to A, chromosome 17 at 72,846,444 bp
  • A to G, chromosome 18 at 11,840,515 bp
  • G to T, chromosome 18 at 36,953,058 bp
  • A to G, chromosome 18 at 37,021,608 bp
  • A to T, chromosome 18 at 57,941,013 bp
  • C to T, chromosome 19 at 3,717,241 bp
  • A to C, chromosome 19 at 45,965,435 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7411 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045492-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.