Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7463Btlr/Mmmh
Stock Number:
045537-MU
Citation ID:
RRID:MMRRC_045537-MU
Other Names:
R7463 (G1)
Major Collection:

Strain Information

Kif5a
Name: kinesin family member 5A
Synonyms: Kns, Kif5, D10Bwg0738e, Khc
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16572
VEGA: 10
HGNC: HGNC:6323
Homologene: 55861
Hgf
Name: hepatocyte growth factor
Synonyms: scatter factor, NK1, SF/HGF, HGF/SF, NK2, C230052L06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15234
HGNC: HGNC:4893
Homologene: 503
Dlx5
Name: distal-less homeobox 5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13395
HGNC: HGNC:2918
Homologene: 3825
Nudc
Name: nudC nuclear distribution protein
Synonyms: NudC, Silg92
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18221
HGNC: HGNC:8045
Homologene: 4812
Dnmt1
Name: DNA methyltransferase 1
Synonyms: MTase, Dnmt1o, Cxxc9, MommeD2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13433
VEGA: 9
HGNC: HGNC:2976
Homologene: 124071
Timeless
Name: timeless circadian clock 1
Synonyms: tim
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21853
Homologene: 31206
Bysl
Name: bystin-like
Synonyms: Enp1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 53414
VEGA: 17
HGNC: HGNC:1157
Homologene: 2991
Dip2b
Name: disco interacting protein 2 homolog B
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239667
Homologene: 72227
Racgap1
Name: Rac GTPase-activating protein 1
Synonyms: MgcRacGAP, GTPase, Band25, gtl11
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 26934
HGNC: HGNC:9804
Homologene: 8077
Zfp516
Name: zinc finger protein 516
Synonyms: C330029B10Rik, Zfp26l
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 329003
VEGA: 18
Homologene: 37122
Ddx6
Name: DEAD-box helicase 6
Synonyms: mRCK/P54, HLR2, E230023J21Rik, p54, rck, 1110001P04Rik, C430015D01Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 6
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13209
VEGA: 9
HGNC: HGNC:2747
Homologene: 3238
Coch
Name: cochlin
Synonyms: Coch-5B2, D12H14S564E
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 12810
VEGA: 12
HGNC: HGNC:2180
Homologene: 20868
Lhx2
Name: LIM homeobox protein 2
Synonyms: Lh-2, LH2A, apterous, ap
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16870
HGNC: HGNC:6594
Homologene: 55848
Hjurp
Name: Holliday junction recognition protein
Synonyms: C330011F01Rik, A730008H23Rik, 6430706D22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381280
Homologene: 10184
Igf2r
Name: insulin-like growth factor 2 receptor
Synonyms: Mpr300, CI-MPR, IGF-II/CI-MPR, M6P/IGF2R, CD222, mannose-6-phosphate receptor, cation independent
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16004
HGNC: HGNC:5467
Homologene: 676
Ncapg
Name: non-SMC condensin I complex, subunit G
Synonyms: MFT.M05.13, Hcapg, 5730507H05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 54392
Homologene: 44071
Tor1aip1
Name: torsin A interacting protein 1
Synonyms: LAP1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 208263
Homologene: 9208
Kcnd2
Name: potassium voltage-gated channel, Shal-related family, member 2
Synonyms: Kv4.2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16508
HGNC: HGNC:6238
Homologene: 40828
Acta2
Name: actin alpha 2, smooth muscle, aorta
Synonyms: Actvs, a-SMA, 0610041G09Rik, SMalphaA, alphaSMA, SMAalpha
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 11475
VEGA: 19
HGNC: HGNC:130
Homologene: 133938
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Pcdh7
Name: protocadherin 7
Synonyms: BH-protocadherin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 54216
HGNC: HGNC:8659
Homologene: 36101
Or52h9
Name: olfactory receptor family 52 subfamily H member 9
Synonyms: GA_x6K02T2PBJ9-7179540-7180481, MOR31-11, Olfr651
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258809
Homologene: 64922
Wdr11
Name: WD repeat domain 11
Synonyms: 2900055P10Rik, Wdr11, Brwd2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 207425
Homologene: 41229
Fer1l6
Name: fer-1 like family member 6
Synonyms: EG631797
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 631797
Homologene: 53396
Pcdhgb8
Name: protocadherin gamma subfamily B, 8
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93705
Homologene: 81868
Cul9
Name: cullin 9
Synonyms: 1810035I07Rik, Parc
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 78309
Homologene: 56696
Rb1cc1
Name: RB1-inducible coiled-coil 1
Synonyms: LaXp180, 2900055E04Rik, Cc1, 5930404L04Rik, Fip200
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12421
Homologene: 7659
Carmil3
Name: capping protein regulator and myosin 1 linker 3
Synonyms: Lrrc16b
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 268747
VEGA: 14
Homologene: 74564
Pcdh10
Name: protocadherin 10
Synonyms: 6430703F07Rik, 6430521D13Rik, OL-pc, Olpc
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18526
Homologene: 74967
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Cpt2
Name: carnitine palmitoyltransferase 2
Synonyms: CPTII, CPT II
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12896
HGNC: HGNC:2330
Homologene: 77
Vmn2r102
Name: vomeronasal 2, receptor 102
Synonyms: EG224572
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224572
Homologene: 115024
Adcy2
Name: adenylate cyclase 2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 210044
VEGA: 13
HGNC: HGNC:233
Homologene: 75133
Ermp1
Name: endoplasmic reticulum metallopeptidase 1
Synonyms: D19Ertd410e, D19Wsu12e, b2b2633Clo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226090
Homologene: 121891
Fmnl1
Name: formin-like 1
Synonyms: 8030453N10Rik, formin-related gene in leukocytes
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 57778
HGNC: HGNC:1212
Homologene: 135620
Tmem94
Name: transmembrane protein 94
Synonyms: 2310067B10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71947
Homologene: 8831
Spmap2
Name: sperm microtubule associated protein 2
Synonyms: Theg
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21830
Homologene: 7976
Dnai2
Name: dynein axonemal intermediate chain 2
Synonyms: C030015H18Rik, Dnaic2, b2b3405Clo
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 432611
Homologene: 11311
Gnptab
Name: N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
Synonyms: EG432486
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 432486
Homologene: 32576
Or56a5
Name: olfactory receptor family 56 subfamily A member 5
Synonyms: GA_x6K02T2PBJ9-7773007-7772066, MOR40-1, Olfr683
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259047
Homologene: 133645
Adgrg6
Name: adhesion G protein-coupled receptor G6
Synonyms: LOC215798, 1190004A11Rik, DREG, Gpr126
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215798
Homologene: 10724
Or10g1
Name: olfactory receptor family 10 subfamily G member 1
Synonyms: GA_x6K02T2RJGY-583652-584608, MOR223-6, Olfr1510, MOR29A
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258423
HGNC: HGNC:8170
Homologene: 87788
Mex3d
Name: mex3 RNA binding family member D
Synonyms: Rkhd1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237400
Homologene: 16890
Or8j3
Name: olfactory receptor family 8 subfamily J member 3
Synonyms: GA_x6K02T2Q125-47672825-47671878, MOR185-2, Olfr1045, MTPCR11, Olfr28
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 259019
Homologene: 128246
Abcc10
Name: ATP-binding cassette, sub-family C member 10
Synonyms: Mrp7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224814
HGNC: HGNC:52
Homologene: 58616
Zer1
Name: zyg-11 related, cell cycle regulator
Synonyms: C230075L19Rik, Zyg11bl
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227693
Homologene: 4621
Cyp4f16
Name: cytochrome P450, family 4, subfamily f, polypeptide 16
Synonyms: 2310021J05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 70101
Homologene: 135840
Cyp3a41a
Name: cytochrome P450, family 3, subfamily a, polypeptide 41A
Synonyms: steroid inducible, Cyp3a41
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 53973
HGNC: HGNC:2638
Homologene: 133568
Bpifc
Name: BPI fold containing family C
Synonyms: Bpil2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 270757
Homologene: 18383
Ptpn18
Name: protein tyrosine phosphatase, non-receptor type 18
Synonyms: HSCF, FLP1, Ptpk1, PTP-K1, PTP-HSCF
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19253
HGNC: HGNC:9649
Homologene: 74971
Or10g9
Name: olfactory receptor family 10 subfamily G member 9
Synonyms: GA_x6K02T2PVTD-33699706-33698771, MOR223-1, Olfr979
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 259112
VEGA: 9
Homologene: 81556
Ptgr2
Name: prostaglandin reductase 2
Synonyms: B830026H24Rik, 9630002F03Rik, 1810016I24Rik, PGR-2, Zadh1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 77219
Homologene: 39824
Krt33b
Name: keratin 33B
Synonyms: Ha3, Ha4, mHa3, Krt1-3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16671
Homologene: 74433
Or2d4
Name: olfactory receptor family 2 subfamily D member 4
Synonyms: GA_x6K02T2PBJ9-9325348-9324416, MOR260-3, Olfr710
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258594
Homologene: 27218
Rnf166
Name: ring finger protein 166
Synonyms: 1110031E24Rik, Zfp313l
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 68718
Homologene: 35335
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 6,249,180 bp
  • G to A, chromosome 1 at 34,473,364 bp
  • CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT to C, chromosome 1 at 88,266,277 bp
  • A to T, chromosome 1 at 156,007,609 bp
  • A to T, chromosome 2 at 30,113,437 bp
  • G to A, chromosome 2 at 38,351,846 bp
  • T to A, chromosome 2 at 76,920,460 bp
  • T to C, chromosome 2 at 86,197,838 bp
  • A to T, chromosome 3 at 45,383,572 bp
  • A to T, chromosome 3 at 113,569,884 bp
  • G to T, chromosome 3 at 129,740,015 bp
  • A to T, chromosome 4 at 107,908,157 bp
  • A to C, chromosome 4 at 133,534,403 bp
  • G to A, chromosome 5 at 16,578,450 bp
  • T to C, chromosome 5 at 22,103,435 bp
  • T to A, chromosome 5 at 45,694,092 bp
  • A to G, chromosome 5 at 57,720,998 bp
  • T to A, chromosome 5 at 145,713,564 bp
  • T to C, chromosome 6 at 6,878,316 bp
  • T to A, chromosome 6 at 21,216,498 bp
  • C to T, chromosome 6 at 140,637,726 bp
  • T to C, chromosome 7 at 104,553,482 bp
  • T to A, chromosome 7 at 105,143,937 bp
  • A to T, chromosome 7 at 106,944,173 bp
  • A to T, chromosome 7 at 129,607,086 bp
  • A to T, chromosome 8 at 15,117,679 bp
  • T to A, chromosome 8 at 122,467,987 bp
  • C to T, chromosome 9 at 20,912,225 bp
  • A to G, chromosome 9 at 40,000,564 bp
  • A to G, chromosome 9 at 44,628,729 bp
  • T to A, chromosome 10 at 14,434,396 bp
  • C to T, chromosome 10 at 74,631,770 bp
  • T to C, chromosome 10 at 79,576,715 bp
  • C to T, chromosome 10 at 80,381,698 bp
  • T to C, chromosome 10 at 85,979,334 bp
  • T to G, chromosome 10 at 88,431,389 bp
  • A to G, chromosome 10 at 127,243,724 bp
  • T to C, chromosome 10 at 128,250,426 bp
  • G to T, chromosome 11 at 59,122,860 bp
  • A to G, chromosome 11 at 100,029,563 bp
  • T to C, chromosome 11 at 103,193,128 bp
  • A to C, chromosome 11 at 114,754,406 bp
  • G to T, chromosome 11 at 115,786,256 bp
  • T to A, chromosome 12 at 51,593,625 bp
  • A to T, chromosome 12 at 84,292,298 bp
  • T to C, chromosome 13 at 68,730,280 bp
  • A to G, chromosome 14 at 52,410,711 bp
  • C to T, chromosome 14 at 55,502,396 bp
  • T to A, chromosome 15 at 58,573,601 bp
  • T to A, chromosome 15 at 99,642,958 bp
  • A to G, chromosome 15 at 100,154,157 bp
  • T to C, chromosome 17 at 12,710,645 bp
  • A to T, chromosome 17 at 19,676,624 bp
  • C to T, chromosome 17 at 32,550,787 bp
  • A to T, chromosome 17 at 46,323,772 bp
  • A to G, chromosome 17 at 46,520,476 bp
  • A to T, chromosome 17 at 47,602,471 bp
  • T to C, chromosome 18 at 3,295,094 bp
  • G to A, chromosome 18 at 37,763,427 bp
  • T to A, chromosome 18 at 82,957,108 bp
  • A to T, chromosome 19 at 29,646,262 bp
  • G to A, chromosome 19 at 34,252,531 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7463 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045537-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.