Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7463Btlr/Mmmh
Stock Number:
045537-MU
Citation ID:
RRID:MMRRC_045537-MU
Other Names:
R7463 (G1)
Major Collection:

Strain Information

Kif5a
Name: kinesin family member 5A
Synonyms: Kns, Kif5, D10Bwg0738e, Khc
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16572
VEGA: 10
HGNC: HGNC:6323
Homologene: 55861
Hgf
Name: hepatocyte growth factor
Synonyms: scatter factor, NK1, SF/HGF, HGF/SF, NK2, C230052L06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15234
HGNC: HGNC:4893
Homologene: 503
Dlx5
Name: distal-less homeobox 5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13395
HGNC: HGNC:2918
Homologene: 3825
Nudc
Name: nudC nuclear distribution protein
Synonyms: NudC, Silg92
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18221
HGNC: HGNC:8045
Homologene: 4812
Dnmt1
Name: DNA methyltransferase 1
Synonyms: MTase, Dnmt1o, Cxxc9, MommeD2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13433
VEGA: 9
HGNC: HGNC:2976
Homologene: 124071
Timeless
Name: timeless circadian clock 1
Synonyms: tim
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21853
Homologene: 31206
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 6,249,180 bp
  • G to A, chromosome 1 at 34,473,364 bp
  • CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT to C, chromosome 1 at 88,266,277 bp
  • A to T, chromosome 1 at 156,007,609 bp
  • A to T, chromosome 2 at 30,113,437 bp
  • G to A, chromosome 2 at 38,351,846 bp
  • T to A, chromosome 2 at 76,920,460 bp
  • T to C, chromosome 2 at 86,197,838 bp
  • A to T, chromosome 3 at 45,383,572 bp
  • A to T, chromosome 3 at 113,569,884 bp
  • G to T, chromosome 3 at 129,740,015 bp
  • A to T, chromosome 4 at 107,908,157 bp
  • A to C, chromosome 4 at 133,534,403 bp
  • G to A, chromosome 5 at 16,578,450 bp
  • T to C, chromosome 5 at 22,103,435 bp
  • T to A, chromosome 5 at 45,694,092 bp
  • A to G, chromosome 5 at 57,720,998 bp
  • T to A, chromosome 5 at 145,713,564 bp
  • T to C, chromosome 6 at 6,878,316 bp
  • T to A, chromosome 6 at 21,216,498 bp
  • C to T, chromosome 6 at 140,637,726 bp
  • T to C, chromosome 7 at 104,553,482 bp
  • T to A, chromosome 7 at 105,143,937 bp
  • A to T, chromosome 7 at 106,944,173 bp
  • A to T, chromosome 7 at 129,607,086 bp
  • A to T, chromosome 8 at 15,117,679 bp
  • T to A, chromosome 8 at 122,467,987 bp
  • C to T, chromosome 9 at 20,912,225 bp
  • A to G, chromosome 9 at 40,000,564 bp
  • A to G, chromosome 9 at 44,628,729 bp
  • T to A, chromosome 10 at 14,434,396 bp
  • C to T, chromosome 10 at 74,631,770 bp
  • T to C, chromosome 10 at 79,576,715 bp
  • C to T, chromosome 10 at 80,381,698 bp
  • T to C, chromosome 10 at 85,979,334 bp
  • T to G, chromosome 10 at 88,431,389 bp
  • A to G, chromosome 10 at 127,243,724 bp
  • T to C, chromosome 10 at 128,250,426 bp
  • G to T, chromosome 11 at 59,122,860 bp
  • A to G, chromosome 11 at 100,029,563 bp
  • T to C, chromosome 11 at 103,193,128 bp
  • A to C, chromosome 11 at 114,754,406 bp
  • G to T, chromosome 11 at 115,786,256 bp
  • T to A, chromosome 12 at 51,593,625 bp
  • A to T, chromosome 12 at 84,292,298 bp
  • T to C, chromosome 13 at 68,730,280 bp
  • A to G, chromosome 14 at 52,410,711 bp
  • C to T, chromosome 14 at 55,502,396 bp
  • T to A, chromosome 15 at 58,573,601 bp
  • T to A, chromosome 15 at 99,642,958 bp
  • A to G, chromosome 15 at 100,154,157 bp
  • T to C, chromosome 17 at 12,710,645 bp
  • A to T, chromosome 17 at 19,676,624 bp
  • C to T, chromosome 17 at 32,550,787 bp
  • A to T, chromosome 17 at 46,323,772 bp
  • A to G, chromosome 17 at 46,520,476 bp
  • A to T, chromosome 17 at 47,602,471 bp
  • T to C, chromosome 18 at 3,295,094 bp
  • G to A, chromosome 18 at 37,763,427 bp
  • T to A, chromosome 18 at 82,957,108 bp
  • A to T, chromosome 19 at 29,646,262 bp
  • G to A, chromosome 19 at 34,252,531 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7463 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045537-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.