Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7569Btlr/Mmmh
Stock Number:
045657-MU
Citation ID:
RRID:MMRRC_045657-MU
Other Names:
R7569 (G1)
Major Collection:

Strain Information

Sema6d
Name: sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D
Synonyms: 1110067B02Rik, Sema6D-6, Sema6D-5, Sema6D-4, Sema6D-2, Sema6D-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 214968
Homologene: 16195
Mtarc2
Name: mitochondrial amidoxime reducing component 2
Synonyms: 2810484M10Rik, Mosc2, Marc2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67247
Homologene: 9904
Taok1
Name: TAO kinase 1
Synonyms: D130018F14Rik, 2810468K05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216965
Homologene: 27041
Smarcad1
Name: SNF2 related chromatin remodeling ATPase with DExD box 1
Synonyms: D6Pas1, Etl1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13990
Homologene: 5301
Dhx38
Name: DEAH-box helicase 38
Synonyms: Prp16, Ddx38, 5730550P09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 64340
Homologene: 8512
Ankrd12
Name: ankyrin repeat domain 12
Synonyms: ANCO-2, GAC-1, 2900001A12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106585
Homologene: 9059
Cep131
Name: centrosomal protein 131
Synonyms: AZ1, Azi1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12009
Homologene: 7638
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: apollon, Bruce, A430032G04Rik, D630005A10Rik, A430040A19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Nampt
Name: nicotinamide phosphoribosyltransferase
Synonyms: 1110035O14Rik, Visfatin, Pbef1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 59027
VEGA: 12
Homologene: 4201
Ascc2
Name: activating signal cointegrator 1 complex subunit 2
Synonyms: 2610034L15Rik, ASC1p100, 1700011I11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 75452
Homologene: 41774
Rock1
Name: Rho-associated coiled-coil containing protein kinase 1
Synonyms: Rock-I, 1110055K06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 19877
VEGA: 18
Homologene: 55899
Dmxl2
Name: Dmx-like 2
Synonyms: E130119P06Rik, 6430411K14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235380
HGNC: HGNC:2938
Homologene: 41022
Slc18a2
Name: solute carrier family 18 (vesicular monoamine), member 2
Synonyms: Vmat2, 1110037L13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 214084
VEGA: 19
Homologene: 2298
Robo2
Name: roundabout guidance receptor 2
Synonyms: 9430089E08Rik, D230004I22Rik, 2600013A04Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 268902
Homologene: 43188
C6
Name: complement component 6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12274
HGNC: HGNC:1339
Homologene: 47
Slc39a14
Name: solute carrier family 39 (zinc transporter), member 14
Synonyms: G630015O18Rik, Zip14
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 213053
Homologene: 15037
St3gal3
Name: ST3 beta-galactoside alpha-2,3-sialyltransferase 3
Synonyms: ST3Gal III, Siat3, Siat6
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20441
Homologene: 7539
Srebf1
Name: sterol regulatory element binding transcription factor 1
Synonyms: SREBP-1, ADD-1, SREBP-1c, SREBP-1a, SREBP1, SREBP1c, bHLHd1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20787
Homologene: 3079
Slc12a4
Name: solute carrier family 12, member 4
Synonyms: KCC1, K-Cl Co-transporter-1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20498
Homologene: 21056
Cul4a
Name: cullin 4A
Synonyms: 2810470J21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 99375
HGNC: HGNC:2554
Homologene: 81724
Zfp507
Name: zinc finger protein 507
Synonyms: A230056M16Rik, 1810022O10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 668501
Homologene: 8942
Ppp4r3b
Name: protein phosphatase 4 regulatory subunit 3B
Synonyms: Smek2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 104570
Homologene: 68886
Usp33
Name: ubiquitin specific peptidase 33
Synonyms: Vdu1, 9830169D19Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 170822
Homologene: 8996
Map1s
Name: microtubule-associated protein 1S
Synonyms: VCY2IP1, 6430517J16Rik, Bpy2ip1, Map8, Mtap1s
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270058
Homologene: 10047
Styxl2
Name: serine/threonine/tyrosine interacting like 2
Synonyms: C130085G02Rik, Dusp27
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240892
Homologene: 18949
Pierce1
Name: piercer of microtubule wall 1
Synonyms: 1700007K13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69327
Homologene: 35416
Lama2
Name: laminin, alpha 2
Synonyms: merosin, mer
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16773
HGNC: HGNC:6482
Homologene: 37306
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: nesprin-2, syne-2, D12Ertd777e, 6820443O06Rik, Nesp2g, Cpfl8, diminished cone electroretinogram, dice
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319565
Homologene: 56700
Stradb
Name: STE20-related kinase adaptor beta
Synonyms: PRO1038, D1Ucla2, Als2cr2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227154
Homologene: 10237
Asic3
Name: acid-sensing ion channel 3
Synonyms: DRASIC, Accn3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 171209
HGNC: HGNC:101
Homologene: 20999
Nlrp1a
Name: NLR family, pyrin domain containing 1A
Synonyms: Nalp1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 195046
Homologene: 133820
Tmem62
Name: transmembrane protein 62
Synonyms: B830009D23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 96957
Homologene: 11801
Rp1
Name: retinitis pigmentosa 1 (human)
Synonyms: oxygen-regulated protein 1, Orp1, mG145, Dcdc3, Rp1h
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19888
Homologene: 4564
Zfp352
Name: zinc finger protein 352
Synonyms: 2czf48
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 236537
Homologene: 45160
BC034090
Name: cDNA sequence BC034090
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 207792
Homologene: 19490
Kmt2b
Name: lysine (K)-specific methyltransferase 2B
Synonyms: 2610014H22Rik, Mll2, Wbp7
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75410
Homologene: 22838
Npsr1
Name: neuropeptide S receptor 1
Synonyms: PGR14, VRR1, 9330128H10Rik, Gpr154
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319239
Homologene: 45515
Adgb
Name: androglobin
Synonyms: 9130014G24Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215772
Homologene: 100289
Map3k6
Name: mitogen-activated protein kinase kinase kinase 6
Synonyms: Ask2, MEKK6, MAPKKK6
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 53608
HGNC: HGNC:6858
Homologene: 3435
Vmn2r74
Name: vomeronasal 2, receptor 74
Synonyms: EG546980
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 546980
Homologene: 115466
Sorcs2
Name: sortilin-related VPS10 domain containing receptor 2
Synonyms: VPS10 domain receptor protein
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 81840
Homologene: 56899
Acvrl1
Name: activin A receptor, type II-like 1
Synonyms: Alk1, activin receptor-like kinase-1, Acvrlk1, Alk-1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11482
HGNC: HGNC:175
Homologene: 20058
Apol6
Name: apolipoprotein L 6
Synonyms: 2310076O14Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 71939
Homologene: 49940
Epha1
Name: Eph receptor A1
Synonyms: Esk, 5730453L17Rik, Eph
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13835
HGNC: HGNC:3385
Homologene: 3835
Lgr5
Name: leucine rich repeat containing G protein coupled receptor 5
Synonyms: Gpr49
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14160
HGNC: HGNC:4504
Homologene: 20807
Col8a1
Name: collagen, type VIII, alpha 1
Synonyms: Col8a-1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12837
HGNC: HGNC:2215
Homologene: 22423
Ankub1
Name: ankyrin repeat and ubiquitin domain containing 1
Synonyms: LOC242037, Gm410
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242037
Homologene: 54680
Or4d6
Name: olfactory receptor family 4 subfamily D member 6
Synonyms: GA_x6K02T2RE5P-2468394-2467450, MOR239-5, Olfr1428
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258673
Homologene: 17339
Nuak2
Name: NUAK family, SNF1-like kinase, 2
Synonyms: 1200013B22Rik, Snark
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74137
Homologene: 12539
Or5ak23
Name: olfactory receptor family 5 subfamily AK member 23
Synonyms: GA_x6K02T2Q125-46891524-46890580, MOR203-2, Olfr993
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258427
Homologene: 79352
Sult2a2
Name: sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 2
Synonyms: mSTa2, Sth2, C730007P19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043194
Bcl11a
Name: BCL11 transcription factor A
Synonyms: mouse myeloid leukemia gene, COUP-TF interacting protein 1, CTIP1, Evi9, 2810047E18Rik, D930021L15Rik, Evi9c, Evi9b, Evi9a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14025
Homologene: 11284
Hus1b
Name: HUS1 checkpoint clamp component B
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 210554
Homologene: 51833
Pycr2
Name: pyrroline-5-carboxylate reductase family, member 2
Synonyms: 1810018M05Rik, P5cr2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 69051
Homologene: 8343
9330182O14Rik
Name: RIKEN cDNA 9330182O14 gene
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 328531
VEGA: 15
Pramel51
Name: PRAME like 51
Synonyms: Gm10436
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100039315
VEGA: 12
Homologene: 103830
U2af1l4
Name: U2 small nuclear RNA auxiliary factor 1-like 4
Synonyms: auxiliary factor 26, U2af26
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233073
Homologene: 134014
Trav9-1
Name: T cell receptor alpha variable 9-1
Synonyms: Gm13947
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 627324
Gm49333
Name: predicted gene, 49333
Type: Gene
Species: Mouse
Chromosome: 16
Dynlt1f
Name: dynein light chain Tctex-type 1F
Synonyms: Dynlt1e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100040531
VEGA: 17
Homologene: 4754
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 4,284,840 bp
  • A to G, chromosome 1 at 58,991,151 bp
  • G to A, chromosome 1 at 132,316,281 bp
  • T to A, chromosome 1 at 155,217,405 bp
  • T to C, chromosome 1 at 166,108,035 bp
  • T to C, chromosome 1 at 180,904,518 bp
  • A to T, chromosome 1 at 184,841,425 bp
  • TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC to TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC, chromosome 2 at 28,466,110 bp
  • A to G, chromosome 2 at 85,414,135 bp
  • A to T, chromosome 2 at 121,006,930 bp
  • A to G, chromosome 2 at 124,657,972 bp
  • G to A, chromosome 3 at 57,665,618 bp
  • T to A, chromosome 3 at 152,391,665 bp
  • C to T, chromosome 4 at 90,223,659 bp
  • A to G, chromosome 4 at 117,964,356 bp
  • A to G, chromosome 4 at 133,250,077 bp
  • A to G, chromosome 5 at 24,414,048 bp
  • A to G, chromosome 5 at 36,025,876 bp
  • T to A, chromosome 6 at 17,282,079 bp
  • T to A, chromosome 6 at 42,365,422 bp
  • T to A, chromosome 6 at 65,052,711 bp
  • T to C, chromosome 7 at 13,779,505 bp
  • A to T, chromosome 7 at 30,563,557 bp
  • A to G, chromosome 7 at 30,569,553 bp
  • T to A, chromosome 7 at 35,794,544 bp
  • A to C, chromosome 7 at 85,952,336 bp
  • A to G, chromosome 8 at 13,123,493 bp
  • T to C, chromosome 8 at 70,913,498 bp
  • A to G, chromosome 8 at 105,945,847 bp
  • A to G, chromosome 8 at 109,560,695 bp
  • A to G, chromosome 9 at 24,313,730 bp
  • A to G, chromosome 9 at 54,415,987 bp
  • A to T, chromosome 10 at 10,431,252 bp
  • A to G, chromosome 10 at 27,265,050 bp
  • T to C, chromosome 10 at 115,462,756 bp
  • G to A, chromosome 11 at 4,679,506 bp
  • G to T, chromosome 11 at 24,085,458 bp
  • T to C, chromosome 11 at 29,188,540 bp
  • G to T, chromosome 11 at 60,200,121 bp
  • T to C, chromosome 11 at 71,109,043 bp
  • A to T, chromosome 11 at 77,555,614 bp
  • G to A, chromosome 11 at 120,066,713 bp
  • T to A, chromosome 12 at 32,850,434 bp
  • A to G, chromosome 12 at 75,927,390 bp
  • A to T, chromosome 12 at 88,176,315 bp
  • A to G, chromosome 13 at 30,946,864 bp
  • T to C, chromosome 14 at 53,488,124 bp
  • T to C, chromosome 14 at 70,309,827 bp
  • A to G, chromosome 15 at 4,789,581 bp
  • A to T, chromosome 15 at 40,144,948 bp
  • A to C, chromosome 15 at 77,050,698 bp
  • A to G, chromosome 15 at 101,135,755 bp
  • T to A, chromosome 16 at 20,642,487 bp
  • T to A, chromosome 16 at 57,627,192 bp
  • T to A, chromosome 16 at 74,035,115 bp
  • A to G, chromosome 17 at 6,655,782 bp
  • A to T, chromosome 17 at 65,982,905 bp
  • G to T, chromosome 17 at 74,598,082 bp
  • A to T, chromosome 18 at 10,140,194 bp
  • T to C, chromosome 19 at 12,109,021 bp
  • G to A, chromosome 19 at 59,284,152 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7569 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045657-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.