Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7569Btlr/Mmmh
Stock Number:
045657-MU
Citation ID:
RRID:MMRRC_045657-MU
Other Names:
R7569 (G1)
Major Collection:

Strain Information

Sema6d
Name: sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D
Synonyms: 1110067B02Rik, Sema6D-6, Sema6D-5, Sema6D-4, Sema6D-2, Sema6D-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 214968
Homologene: 16195
Mtarc2
Name: mitochondrial amidoxime reducing component 2
Synonyms: 2810484M10Rik, Mosc2, Marc2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67247
Homologene: 9904
Taok1
Name: TAO kinase 1
Synonyms: D130018F14Rik, 2810468K05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216965
Homologene: 27041
Smarcad1
Name: SNF2 related chromatin remodeling ATPase with DExD box 1
Synonyms: D6Pas1, Etl1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13990
Homologene: 5301
Dhx38
Name: DEAH-box helicase 38
Synonyms: Prp16, Ddx38, 5730550P09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 64340
Homologene: 8512
Ankrd12
Name: ankyrin repeat domain 12
Synonyms: ANCO-2, GAC-1, 2900001A12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106585
Homologene: 9059
Cep131
Name: centrosomal protein 131
Synonyms: AZ1, Azi1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12009
Homologene: 7638
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 4,284,840 bp
  • A to G, chromosome 1 at 58,991,151 bp
  • G to A, chromosome 1 at 132,316,281 bp
  • T to A, chromosome 1 at 155,217,405 bp
  • T to C, chromosome 1 at 166,108,035 bp
  • T to C, chromosome 1 at 180,904,518 bp
  • A to T, chromosome 1 at 184,841,425 bp
  • TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC to TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC, chromosome 2 at 28,466,110 bp
  • A to G, chromosome 2 at 85,414,135 bp
  • A to T, chromosome 2 at 121,006,930 bp
  • A to G, chromosome 2 at 124,657,972 bp
  • G to A, chromosome 3 at 57,665,618 bp
  • T to A, chromosome 3 at 152,391,665 bp
  • C to T, chromosome 4 at 90,223,659 bp
  • A to G, chromosome 4 at 117,964,356 bp
  • A to G, chromosome 4 at 133,250,077 bp
  • A to G, chromosome 5 at 24,414,048 bp
  • A to G, chromosome 5 at 36,025,876 bp
  • T to A, chromosome 6 at 17,282,079 bp
  • T to A, chromosome 6 at 42,365,422 bp
  • T to A, chromosome 6 at 65,052,711 bp
  • T to C, chromosome 7 at 13,779,505 bp
  • A to T, chromosome 7 at 30,563,557 bp
  • A to G, chromosome 7 at 30,569,553 bp
  • T to A, chromosome 7 at 35,794,544 bp
  • A to C, chromosome 7 at 85,952,336 bp
  • A to G, chromosome 8 at 13,123,493 bp
  • T to C, chromosome 8 at 70,913,498 bp
  • A to G, chromosome 8 at 105,945,847 bp
  • A to G, chromosome 8 at 109,560,695 bp
  • A to G, chromosome 9 at 24,313,730 bp
  • A to G, chromosome 9 at 54,415,987 bp
  • A to T, chromosome 10 at 10,431,252 bp
  • A to G, chromosome 10 at 27,265,050 bp
  • T to C, chromosome 10 at 115,462,756 bp
  • G to A, chromosome 11 at 4,679,506 bp
  • G to T, chromosome 11 at 24,085,458 bp
  • T to C, chromosome 11 at 29,188,540 bp
  • G to T, chromosome 11 at 60,200,121 bp
  • T to C, chromosome 11 at 71,109,043 bp
  • A to T, chromosome 11 at 77,555,614 bp
  • G to A, chromosome 11 at 120,066,713 bp
  • T to A, chromosome 12 at 32,850,434 bp
  • A to G, chromosome 12 at 75,927,390 bp
  • A to T, chromosome 12 at 88,176,315 bp
  • A to G, chromosome 13 at 30,946,864 bp
  • T to C, chromosome 14 at 53,488,124 bp
  • T to C, chromosome 14 at 70,309,827 bp
  • A to G, chromosome 15 at 4,789,581 bp
  • A to T, chromosome 15 at 40,144,948 bp
  • A to C, chromosome 15 at 77,050,698 bp
  • A to G, chromosome 15 at 101,135,755 bp
  • T to A, chromosome 16 at 20,642,487 bp
  • T to A, chromosome 16 at 57,627,192 bp
  • T to A, chromosome 16 at 74,035,115 bp
  • A to G, chromosome 17 at 6,655,782 bp
  • A to T, chromosome 17 at 65,982,905 bp
  • G to T, chromosome 17 at 74,598,082 bp
  • A to T, chromosome 18 at 10,140,194 bp
  • T to C, chromosome 19 at 12,109,021 bp
  • G to A, chromosome 19 at 59,284,152 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7569 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045657-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.