Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7620Btlr/Mmmh
Stock Number:
045687-MU
Citation ID:
RRID:MMRRC_045687-MU
Other Names:
R7620 (G1)
Major Collection:

Strain Information

Myo5a
Name: myosin VA
Synonyms: MVa, MyoVA, Myo5, flail, 9630007J19Rik, Dbv
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17918
HGNC: HGNC:7602
Homologene: 20100
Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: 6030405M08Rik, D530039E11Rik, 4921505C17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78757
VEGA: 15
Homologene: 34317
Socs3
Name: suppressor of cytokine signaling 3
Synonyms: EF-10, SOCS-3, cytokine-inducible SH2 protein 3, CIS3, STAT-induced STAT inhibitor 3, SSI-3, E2a-Pbx1 target gene in fibroblasts 10, Cish3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12702
Homologene: 2941
Cyp39a1
Name: cytochrome P450, family 39, subfamily a, polypeptide 1
Synonyms: oxysterol 7-alpha-hydroxylase
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 56050
VEGA: 17
Homologene: 9580
Rnmt
Name: RNA (guanine-7-) methyltransferase
Synonyms: 2610002P10Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67897
Homologene: 2816
Garem1
Name: GRB2 associated regulator of MAPK1 subtype 1
Synonyms: LOC381126, Fam59a, Garem
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 381126
VEGA: 18
Homologene: 11237
Mcm3ap
Name: minichromosome maintenance complex component 3 associated protein
Synonyms: GANP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 54387
VEGA: 10
HGNC: HGNC:6946
Homologene: 2902
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 31,203,380 bp
  • A to G, chromosome 1 at 46,268,634 bp
  • A to G, chromosome 1 at 75,313,448 bp
  • TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC to TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC, chromosome 2 at 28,466,110 bp
  • A to G, chromosome 2 at 30,408,078 bp
  • G to T, chromosome 2 at 72,229,078 bp
  • A to C, chromosome 2 at 90,085,633 bp
  • A to G, chromosome 3 at 88,911,307 bp
  • T to A, chromosome 3 at 106,160,435 bp
  • T to A, chromosome 4 at 96,056,662 bp
  • G to T, chromosome 4 at 101,752,073 bp
  • T to A, chromosome 4 at 112,715,817 bp
  • G to A, chromosome 4 at 154,059,257 bp
  • A to T, chromosome 5 at 35,511,850 bp
  • T to C, chromosome 6 at 48,467,086 bp
  • C to T, chromosome 7 at 8,483,223 bp
  • C to A, chromosome 7 at 104,996,755 bp
  • A to G, chromosome 8 at 45,009,850 bp
  • T to A, chromosome 9 at 75,164,136 bp
  • T to A, chromosome 9 at 123,779,846 bp
  • A to T, chromosome 10 at 34,127,618 bp
  • A to G, chromosome 10 at 76,470,433 bp
  • G to C, chromosome 11 at 70,969,779 bp
  • T to C, chromosome 11 at 95,387,865 bp
  • A to G, chromosome 11 at 98,666,603 bp
  • A to T, chromosome 11 at 101,283,414 bp
  • T to A, chromosome 11 at 104,832,143 bp
  • A to G, chromosome 11 at 117,967,570 bp
  • A to G, chromosome 12 at 9,016,042 bp
  • A to T, chromosome 14 at 31,303,906 bp
  • T to A, chromosome 14 at 55,580,340 bp
  • C to T, chromosome 15 at 6,772,154 bp
  • T to G, chromosome 15 at 75,998,848 bp
  • A to G, chromosome 16 at 36,856,410 bp
  • T to C, chromosome 17 at 35,867,299 bp
  • G to A, chromosome 17 at 43,725,653 bp
  • A to G, chromosome 17 at 56,997,551 bp
  • T to C, chromosome 18 at 21,129,841 bp
  • A to G, chromosome 18 at 44,104,617 bp
  • T to A, chromosome 18 at 68,314,034 bp
  • T to C, chromosome 18 at 80,130,487 bp
  • A to G, chromosome 19 at 12,587,937 bp
  • C to A, chromosome X at 72,270,259 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7620 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045687-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.